Mutagenetix > Incidental Mutation

Incidental Mutation 'R9737:Vmn2r99'

731711

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r99

Ensembl Gene

ENSMUSG00000090304

Gene Name

vomeronasal 2, receptor 99

Synonyms

EG665376

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R9737 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19361949-19401098 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 19362301 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 56 (E56A)

Ref Sequence

ENSEMBL: ENSMUSP00000135236 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]

AlphaFold

H3BK37

Predicted Effect

probably benign
Transcript: ENSMUST00000176107
AA Change: E56A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: E56A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	81	448	5.7e-33	PFAM
Pfam:NCD3G	508	561	1.8e-21	PFAM
Pfam:7tm_3	593	829	4.6e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231989
AA Change: E56A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adnp	T	C	2: 168,184,998	K126E	possibly damaging	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Ccnjl	C	A	11: 43,585,339	T263K	probably benign	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Epha2	A	G	4: 141,318,503	E446G	probably benign	Het
Gm4788	A	T	1: 139,781,134	I12N	probably damaging	Het
Gtf2ird1	A	G	5: 134,379,940	Y702H	probably damaging	Het
Igkv10-96	T	C	6: 68,631,973	T113A	probably benign	Het
Jhy	T	C	9: 40,897,452	E671G	probably damaging	Het
Ngdn	A	G	14: 55,021,882	K161R	possibly damaging	Het
Pabpc4l	A	G	3: 46,446,832	S126P	probably damaging	Het
Phlpp2	G	A	8: 109,937,082	D918N	probably damaging	Het
Pkd2	A	T	5: 104,503,483	H899L	possibly damaging	Het
Pou6f1	A	G	15: 100,583,401	S301P	probably benign	Het
Sidt1	A	G	16: 44,281,880	Y306H	probably damaging	Het
Trav13-1	A	T	14: 53,545,053	T14S	probably benign	Het
Vnn3	A	G	10: 23,865,915	M373V	probably benign	Het
Zkscan5	A	G	5: 145,205,326	H11R	probably benign	Het

Other mutations in Vmn2r99

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Vmn2r99	APN	17	19378854	missense	probably benign	0.01
IGL01113:Vmn2r99	APN	17	19394256	missense	probably benign	0.20
IGL01138:Vmn2r99	APN	17	19382623	missense	probably damaging	0.97
IGL01646:Vmn2r99	APN	17	19393658	splice site	probably benign
IGL01769:Vmn2r99	APN	17	19380115	missense	probably damaging	1.00
IGL02112:Vmn2r99	APN	17	19380232	missense	probably null	0.99
IGL02891:Vmn2r99	APN	17	19378690	nonsense	probably null
IGL03132:Vmn2r99	APN	17	19378223	nonsense	probably null
FR4548:Vmn2r99	UTSW	17	19394285	missense	probably damaging	0.97
FR4976:Vmn2r99	UTSW	17	19394285	missense	probably damaging	0.97
PIT4382001:Vmn2r99	UTSW	17	19394343	missense	probably damaging	1.00
R0196:Vmn2r99	UTSW	17	19394573	missense	probably benign	0.00
R0720:Vmn2r99	UTSW	17	19379043	missense	probably benign	0.00
R1501:Vmn2r99	UTSW	17	19362259	missense	possibly damaging	0.93
R1519:Vmn2r99	UTSW	17	19380060	missense	probably benign	0.00
R1670:Vmn2r99	UTSW	17	19362252	missense	probably benign	0.37
R1682:Vmn2r99	UTSW	17	19377945	missense	probably damaging	0.97
R1873:Vmn2r99	UTSW	17	19362153	missense	probably benign	0.25
R1967:Vmn2r99	UTSW	17	19378815	missense	probably benign	0.01
R2101:Vmn2r99	UTSW	17	19377991	missense	probably damaging	1.00
R2474:Vmn2r99	UTSW	17	19378629	missense	probably benign	0.04
R2519:Vmn2r99	UTSW	17	19378708	missense	probably damaging	0.99
R3911:Vmn2r99	UTSW	17	19394373	missense	possibly damaging	0.92
R3947:Vmn2r99	UTSW	17	19378990	missense	probably benign	0.40
R3949:Vmn2r99	UTSW	17	19378990	missense	probably benign	0.40
R4016:Vmn2r99	UTSW	17	19378570	missense	possibly damaging	0.86
R4413:Vmn2r99	UTSW	17	19379260	missense	probably damaging	1.00
R4594:Vmn2r99	UTSW	17	19393662	missense	probably damaging	1.00
R4999:Vmn2r99	UTSW	17	19362135	start codon destroyed	probably null	0.96
R5206:Vmn2r99	UTSW	17	19378606	missense	probably benign	0.40
R5362:Vmn2r99	UTSW	17	19379339	missense	probably benign	0.00
R5377:Vmn2r99	UTSW	17	19379269	missense	probably damaging	1.00
R5455:Vmn2r99	UTSW	17	19394146	nonsense	probably null
R6021:Vmn2r99	UTSW	17	19377948	missense	probably damaging	1.00
R6059:Vmn2r99	UTSW	17	19378980	missense	probably benign	0.00
R6214:Vmn2r99	UTSW	17	19382558	missense	probably benign	0.19
R6215:Vmn2r99	UTSW	17	19382558	missense	probably benign	0.19
R6313:Vmn2r99	UTSW	17	19382605	missense	probably damaging	1.00
R6646:Vmn2r99	UTSW	17	19380031	missense	probably damaging	1.00
R6810:Vmn2r99	UTSW	17	19380034	missense	probably benign	0.20
R6885:Vmn2r99	UTSW	17	19380195	missense	possibly damaging	0.52
R6991:Vmn2r99	UTSW	17	19378110	missense	probably benign	0.03
R7060:Vmn2r99	UTSW	17	19394564	nonsense	probably null
R7090:Vmn2r99	UTSW	17	19393710	missense	possibly damaging	0.83
R7094:Vmn2r99	UTSW	17	19379311	missense	probably benign	0.00
R7449:Vmn2r99	UTSW	17	19379145	missense	probably benign	0.01
R7789:Vmn2r99	UTSW	17	19393817	missense	possibly damaging	0.91
R8039:Vmn2r99	UTSW	17	19380040	missense	probably benign	0.00
R8493:Vmn2r99	UTSW	17	19393758	missense	probably benign	0.15
R8511:Vmn2r99	UTSW	17	19394181	missense	probably damaging	1.00
R8715:Vmn2r99	UTSW	17	19393660	critical splice acceptor site	probably benign
R9462:Vmn2r99	UTSW	17	19378126	nonsense	probably null
R9681:Vmn2r99	UTSW	17	19378627	missense	probably damaging	1.00
Z1088:Vmn2r99	UTSW	17	19379301	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- GAACTAATAGGATGGTCGCTTGG -3'
(R):5'- CACAGTTGAAGTTTCCATTCCC -3'

Sequencing Primer
(F):5'- ATAGGATGGTCGCTTGGATTTTTATC -3'
(R):5'- TCCCCCTGAGTGAAGAAAATAATCTG -3'

Posted On

2022-11-14