Mutagenetix > Incidental Mutation

Incidental Mutation 'R9738:Cntnap2'

731720

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9738 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CCACATAAACAACACACA to CCACA at 46015439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000114641

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd12b	A	G	12: 70,169,265	T199A	probably benign	Het
Ank2	A	G	3: 126,943,472	F2921S	unknown	Het
Atg12	A	G	18: 46,741,438	S37P	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Cdh5	A	G	8: 104,136,697	D413G	probably damaging	Het
Cdk8	A	G	5: 146,299,729	N318S	probably benign	Het
Clasp2	T	A	9: 113,761,597	L68*	probably null	Het
Cpne9	A	C	6: 113,290,440	N194T	probably damaging	Het
Cpxm1	A	G	2: 130,393,382		probably null	Het
Crtc1	T	C	8: 70,387,555	N556S	probably damaging	Het
Gm12888	A	T	4: 121,318,323	C87*	probably null	Het
Hivep2	A	G	10: 14,143,839	E2118G	probably damaging	Het
Hrh4	A	G	18: 13,022,213	N270D	possibly damaging	Het
Iqsec1	G	A	6: 90,694,690	Q77*	probably null	Het
Lars	A	G	18: 42,217,584	W887R	probably damaging	Het
Lgr5	A	G	10: 115,452,622	Y706H	probably damaging	Het
Ltn1	A	T	16: 87,425,636	F170I	probably damaging	Het
Msrb1	T	C	17: 24,739,561	S40P	probably damaging	Het
Myh6	T	C	14: 54,952,302	I1096V	probably benign	Het
Myh7b	A	G	2: 155,614,043	Y116C	probably damaging	Het
Ndrg2	T	C	14: 51,910,781	H41R	possibly damaging	Het
Olfr235	A	G	19: 12,268,505	T92A	probably benign	Het
Spag17	A	G	3: 100,027,210	T603A	possibly damaging	Het
Sugp1	T	A	8: 70,052,606	H74Q	probably benign	Het
Tjp1	T	C	7: 65,336,632	T243A	probably benign	Het
Tsnaxip1	A	G	8: 105,841,758	E358G	possibly damaging	Het
Unc5d	T	A	8: 28,724,304	H410L	probably benign	Het
Usp1	T	C	4: 98,931,435	V378A	probably benign	Het
Wdtc1	A	G	4: 133,295,293	S581P	probably damaging	Het
Zfp947	A	G	17: 22,146,360	V111A	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCTTCAATGCTACAAGCTACCTG -3'
(R):5'- AACTATGAGCCCGTAATGCCAG -3'

Sequencing Primer
(F):5'- CTGGAGGTACCTGGCAGACTTAATC -3'
(R):5'- GCCCGTAATGCCAGTTTAAG -3'

Posted On

2022-11-14