Mutagenetix > Incidental Mutation

Incidental Mutation 'R9738:Ltn1'

731736

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9738 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87425636 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 170 (F170I)

Ref Sequence

ENSEMBL: ENSMUSP00000038775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]

AlphaFold

Q6A009

Predicted Effect

probably damaging
Transcript: ENSMUST00000039449
AA Change: F170I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: F170I

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000232095
AA Change: F170I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd12b	A	G	12: 70,169,265	T199A	probably benign	Het
Ank2	A	G	3: 126,943,472	F2921S	unknown	Het
Atg12	A	G	18: 46,741,438	S37P	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Cdh5	A	G	8: 104,136,697	D413G	probably damaging	Het
Cdk8	A	G	5: 146,299,729	N318S	probably benign	Het
Clasp2	T	A	9: 113,761,597	L68*	probably null	Het
Cntnap2	CCACATAAACAACACACA	CCACA	6: 46,015,439		probably null	Het
Cpne9	A	C	6: 113,290,440	N194T	probably damaging	Het
Cpxm1	A	G	2: 130,393,382		probably null	Het
Crtc1	T	C	8: 70,387,555	N556S	probably damaging	Het
Gm12888	A	T	4: 121,318,323	C87*	probably null	Het
Hivep2	A	G	10: 14,143,839	E2118G	probably damaging	Het
Hrh4	A	G	18: 13,022,213	N270D	possibly damaging	Het
Iqsec1	G	A	6: 90,694,690	Q77*	probably null	Het
Lars	A	G	18: 42,217,584	W887R	probably damaging	Het
Lgr5	A	G	10: 115,452,622	Y706H	probably damaging	Het
Msrb1	T	C	17: 24,739,561	S40P	probably damaging	Het
Myh6	T	C	14: 54,952,302	I1096V	probably benign	Het
Myh7b	A	G	2: 155,614,043	Y116C	probably damaging	Het
Ndrg2	T	C	14: 51,910,781	H41R	possibly damaging	Het
Olfr235	A	G	19: 12,268,505	T92A	probably benign	Het
Spag17	A	G	3: 100,027,210	T603A	possibly damaging	Het
Sugp1	T	A	8: 70,052,606	H74Q	probably benign	Het
Tjp1	T	C	7: 65,336,632	T243A	probably benign	Het
Tsnaxip1	A	G	8: 105,841,758	E358G	possibly damaging	Het
Unc5d	T	A	8: 28,724,304	H410L	probably benign	Het
Usp1	T	C	4: 98,931,435	V378A	probably benign	Het
Wdtc1	A	G	4: 133,295,293	S581P	probably damaging	Het
Zfp947	A	G	17: 22,146,360	V111A	probably benign	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATAACTTTCGAGGTTACCGATATC -3'
(R):5'- AATAGGATCATGATCGCCGTG -3'

Sequencing Primer
(F):5'- CGAGGTTACCGATATCTTTTATATGG -3'
(R):5'- ATCATGATCGCCGTGTTCGAGAG -3'

Posted On

2022-11-14