Incidental Mutation 'R9739:Rapgef6'
ID 731765
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9739 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54513189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000104523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: T285A

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: T285A

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: T285A

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: T285A

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108895
AA Change: T285A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: T285A

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: T285A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000218995
AA Change: T138A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C T 1: 25,592,849 (GRCm39) V313M probably damaging Het
Alg6 G A 4: 99,650,195 (GRCm39) V472I possibly damaging Het
Atp8b2 A G 3: 89,853,403 (GRCm39) V728A probably benign Het
Bach2 T A 4: 32,563,042 (GRCm39) I503N probably damaging Het
Bend3 T C 10: 43,385,847 (GRCm39) L80P possibly damaging Het
Casq1 T C 1: 172,043,051 (GRCm39) D215G possibly damaging Het
Ccdc175 A T 12: 72,186,792 (GRCm39) Y351N probably benign Het
Cd200r4 A T 16: 44,641,142 (GRCm39) probably benign Het
Ctnnal1 T C 4: 56,816,200 (GRCm39) D621G probably damaging Het
Esco1 T A 18: 10,594,218 (GRCm39) H356L probably benign Het
Fhod1 C T 8: 106,064,378 (GRCm39) V191M unknown Het
Fhod3 T C 18: 24,903,566 (GRCm39) L100P probably damaging Het
Fkbp4 T C 6: 128,410,728 (GRCm39) R234G probably benign Het
Flnb A T 14: 7,935,954 (GRCm38) K2265* probably null Het
Fsip2 T C 2: 82,823,896 (GRCm39) F6543S possibly damaging Het
Fyb1 A G 15: 6,670,063 (GRCm39) N594S probably benign Het
Gm17019 G A 5: 15,082,841 (GRCm39) R38* probably null Het
Gm37240 A G 3: 84,417,113 (GRCm39) probably null Het
Gm9195 C T 14: 72,690,264 (GRCm39) D1820N probably damaging Het
Mycbp2 A G 14: 103,520,229 (GRCm39) V729A probably benign Het
Or8g21 G T 9: 38,906,302 (GRCm39) S143* probably null Het
Or9s18 T C 13: 65,300,442 (GRCm39) S135P probably damaging Het
Pde12 T C 14: 26,386,757 (GRCm39) T584A possibly damaging Het
Pfkfb2 T C 1: 130,624,815 (GRCm39) Q515R probably benign Het
Pkhd1 T C 1: 20,420,708 (GRCm39) N2466S probably damaging Het
Plcd1 A G 9: 118,901,195 (GRCm39) V720A possibly damaging Het
Pramel24 T A 4: 143,454,997 (GRCm39) F432I possibly damaging Het
Scyl3 T C 1: 163,771,419 (GRCm39) F255S probably damaging Het
Sfrp5 T A 19: 42,188,247 (GRCm39) M191L probably benign Het
Snrpf C T 10: 93,419,390 (GRCm39) C66Y probably benign Het
Syngr2 T A 11: 117,703,298 (GRCm39) I38N probably damaging Het
Thap1 C T 8: 26,650,990 (GRCm39) H87Y probably benign Het
Tubgcp3 A G 8: 12,699,744 (GRCm39) Y370H probably benign Het
Usp17la A T 7: 104,510,736 (GRCm39) N447I possibly damaging Het
Zfp532 C T 18: 65,757,894 (GRCm39) T609M probably benign Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54,517,534 (GRCm39) missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54,582,134 (GRCm39) missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54,526,989 (GRCm39) missense probably benign
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54,522,127 (GRCm39) nonsense probably null
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8465:Rapgef6 UTSW 11 54,582,308 (GRCm39) missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54,443,700 (GRCm39) critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54,582,169 (GRCm39) missense probably damaging 1.00
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCGACGGTAAATATACATACAGTT -3'
(R):5'- GTCTAGCACCAGGAAAACAGC -3'

Sequencing Primer
(F):5'- ACATCTGTGCATCATATGTGTGC -3'
(R):5'- TTAATCACCCCAACCAAGTATTCACG -3'
Posted On 2022-11-14