Incidental Mutation 'R9739:Flnb'
ID 731769
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9739 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 7935954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 2265 (K2265*)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably null
Transcript: ENSMUST00000052678
AA Change: K2265*
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: K2265*

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C T 1: 25,592,849 (GRCm39) V313M probably damaging Het
Alg6 G A 4: 99,650,195 (GRCm39) V472I possibly damaging Het
Atp8b2 A G 3: 89,853,403 (GRCm39) V728A probably benign Het
Bach2 T A 4: 32,563,042 (GRCm39) I503N probably damaging Het
Bend3 T C 10: 43,385,847 (GRCm39) L80P possibly damaging Het
Casq1 T C 1: 172,043,051 (GRCm39) D215G possibly damaging Het
Ccdc175 A T 12: 72,186,792 (GRCm39) Y351N probably benign Het
Cd200r4 A T 16: 44,641,142 (GRCm39) probably benign Het
Ctnnal1 T C 4: 56,816,200 (GRCm39) D621G probably damaging Het
Esco1 T A 18: 10,594,218 (GRCm39) H356L probably benign Het
Fhod1 C T 8: 106,064,378 (GRCm39) V191M unknown Het
Fhod3 T C 18: 24,903,566 (GRCm39) L100P probably damaging Het
Fkbp4 T C 6: 128,410,728 (GRCm39) R234G probably benign Het
Fsip2 T C 2: 82,823,896 (GRCm39) F6543S possibly damaging Het
Fyb1 A G 15: 6,670,063 (GRCm39) N594S probably benign Het
Gm17019 G A 5: 15,082,841 (GRCm39) R38* probably null Het
Gm37240 A G 3: 84,417,113 (GRCm39) probably null Het
Gm9195 C T 14: 72,690,264 (GRCm39) D1820N probably damaging Het
Mycbp2 A G 14: 103,520,229 (GRCm39) V729A probably benign Het
Or8g21 G T 9: 38,906,302 (GRCm39) S143* probably null Het
Or9s18 T C 13: 65,300,442 (GRCm39) S135P probably damaging Het
Pde12 T C 14: 26,386,757 (GRCm39) T584A possibly damaging Het
Pfkfb2 T C 1: 130,624,815 (GRCm39) Q515R probably benign Het
Pkhd1 T C 1: 20,420,708 (GRCm39) N2466S probably damaging Het
Plcd1 A G 9: 118,901,195 (GRCm39) V720A possibly damaging Het
Pramel24 T A 4: 143,454,997 (GRCm39) F432I possibly damaging Het
Rapgef6 A G 11: 54,513,189 (GRCm39) T285A probably benign Het
Scyl3 T C 1: 163,771,419 (GRCm39) F255S probably damaging Het
Sfrp5 T A 19: 42,188,247 (GRCm39) M191L probably benign Het
Snrpf C T 10: 93,419,390 (GRCm39) C66Y probably benign Het
Syngr2 T A 11: 117,703,298 (GRCm39) I38N probably damaging Het
Thap1 C T 8: 26,650,990 (GRCm39) H87Y probably benign Het
Tubgcp3 A G 8: 12,699,744 (GRCm39) Y370H probably benign Het
Usp17la A T 7: 104,510,736 (GRCm39) N447I possibly damaging Het
Zfp532 C T 18: 65,757,894 (GRCm39) T609M probably benign Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACTAATAAAATCCTACCGTCTGGG -3'
(R):5'- TGACTCCTGAGGGCATAAGG -3'

Sequencing Primer
(F):5'- CTGGGTGTTAGTCAGTTAGTCAGC -3'
(R):5'- CCCAGGACAGGATTAATGTGGTCTC -3'
Posted On 2022-11-14