Mutagenetix > Incidental Mutation

Incidental Mutation 'R9740:Slitrk6'

731811

Institutional Source

Beutler Lab

Gene Symbol

Slitrk6

Ensembl Gene

ENSMUSG00000045871

Gene Name

SLIT and NTRK-like family, member 6

Synonyms

4832410J21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R9740 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110748580-110755149 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 110750012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 754 (L754F)

Ref Sequence

ENSEMBL: ENSMUSP00000077492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078386]

AlphaFold

Q8C110

Predicted Effect

probably benign
Transcript: ENSMUST00000078386
AA Change: L754F

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: L754F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:LRRNT	30	68	4e-15	BLAST
LRR	87	110	1.71e1	SMART
LRR	111	134	3.07e-1	SMART
LRR	135	158	4.44e0	SMART
LRR_TYP	159	182	2.09e-3	SMART
LRR	185	206	6.23e1	SMART
LRRCT	218	268	5.61e-5	SMART
low complexity region	287	301	N/A	INTRINSIC
Blast:LRRNT	327	364	2e-17	BLAST
LRR	388	408	2.68e1	SMART
LRR_TYP	409	432	3.63e-3	SMART
LRR_TYP	433	456	6.23e-2	SMART
LRR_TYP	457	480	3.69e-4	SMART
low complexity region	501	513	N/A	INTRINSIC
LRRCT	516	566	1.53e-6	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	634	642	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	T	G	11: 5,871,721	Y1087D	probably benign	Het
Bdh1	A	G	16: 31,438,035	M37V	possibly damaging	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Clec1b	C	T	6: 129,403,586	S155L	probably benign	Het
Crym	A	T	7: 120,195,438	V186D	probably benign	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Det1	A	T	7: 78,844,253	M1K	probably null	Het
Fam110b	A	G	4: 5,799,070	K163E	probably benign	Het
Fam234a	A	T	17: 26,213,815	V482E	probably damaging	Het
Grin2b	A	G	6: 135,922,870		probably null	Het
Herc1	A	G	9: 66,448,514	E2349G	probably damaging	Het
Kdsr	A	G	1: 106,739,396	Y210H	possibly damaging	Het
Lcn6	A	T	2: 25,681,179	T110S	probably benign	Het
Macf1	T	C	4: 123,372,384	H6807R	probably damaging	Het
Macf1	T	C	4: 123,473,060	Y2636C	probably damaging	Het
Myh2	T	G	11: 67,189,226	I1115S	probably damaging	Het
Npepl1	C	A	2: 174,121,490	N438K	probably damaging	Het
Nrros	G	A	16: 32,144,849	H117Y	possibly damaging	Het
Olfr1148	T	C	2: 87,833,551	S171P	probably damaging	Het
Pitpnm3	T	C	11: 72,056,276	T782A	probably benign	Het
Pla2g4d	T	G	2: 120,277,471	Q319P	probably damaging	Het
Ptcd1	A	T	5: 145,159,484	D266E	probably benign	Het
Sox5	A	T	6: 144,155,221	M14K	probably damaging	Het
Ssmem1	T	A	6: 30,512,455	D32E	possibly damaging	Het
St18	A	T	1: 6,803,063	R341*	probably null	Het
Stag1	T	C	9: 100,705,235	S4P	probably damaging	Het
Suz12	G	T	11: 79,999,094	E144*	probably null	Het
Tex52	A	G	6: 128,379,710	N122S	possibly damaging	Het
Tmem2	A	T	19: 21,844,741	M1167L	probably benign	Het
Tril	A	G	6: 53,818,119	L706P	possibly damaging	Het
Trim65	T	C	11: 116,130,608	D133G	probably benign	Het
Ttc6	A	T	12: 57,689,710	I1166F	probably damaging	Het
Zfp709	C	T	8: 71,889,290	R188C	probably damaging	Het
Zfp974	A	G	7: 27,910,600	C567R	probably damaging	Het
Zmiz1	A	G	14: 25,656,826	D842G	possibly damaging	Het

Other mutations in Slitrk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Slitrk6	APN	14	110751115	missense	probably benign	0.35
IGL01131:Slitrk6	APN	14	110751576	missense	probably damaging	1.00
IGL01294:Slitrk6	APN	14	110750074	missense	probably benign
IGL01295:Slitrk6	APN	14	110751436	missense	possibly damaging	0.50
IGL01762:Slitrk6	APN	14	110751624	missense	probably damaging	1.00
IGL02165:Slitrk6	APN	14	110751817	missense	probably benign	0.41
IGL02546:Slitrk6	APN	14	110749794	missense	probably benign	0.18
IGL03103:Slitrk6	APN	14	110749941	missense	probably benign
PIT1430001:Slitrk6	UTSW	14	110750427	missense	possibly damaging	0.93
PIT4480001:Slitrk6	UTSW	14	110749825	frame shift	probably null
R0035:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0066:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0067:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0069:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0107:Slitrk6	UTSW	14	110751963	missense	possibly damaging	0.69
R0157:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110752293	start gained	probably benign
R0454:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0505:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0633:Slitrk6	UTSW	14	110751885	missense	probably damaging	1.00
R0711:Slitrk6	UTSW	14	110749819	missense	probably damaging	1.00
R0843:Slitrk6	UTSW	14	110750098	missense	probably benign
R1298:Slitrk6	UTSW	14	110751865	missense	possibly damaging	0.94
R1693:Slitrk6	UTSW	14	110750928	missense	probably damaging	1.00
R1756:Slitrk6	UTSW	14	110750552	missense	probably benign
R1998:Slitrk6	UTSW	14	110751823	missense	probably damaging	0.99
R2049:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2140:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2142:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2314:Slitrk6	UTSW	14	110751955	missense	probably damaging	1.00
R2566:Slitrk6	UTSW	14	110750272	missense	probably benign	0.00
R4231:Slitrk6	UTSW	14	110751388	missense	probably benign	0.02
R4236:Slitrk6	UTSW	14	110750148	missense	probably benign	0.07
R4247:Slitrk6	UTSW	14	110750739	missense	probably damaging	1.00
R4576:Slitrk6	UTSW	14	110750170	missense	probably benign	0.05
R4856:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4858:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4859:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4886:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4931:Slitrk6	UTSW	14	110750379	missense	probably damaging	1.00
R5255:Slitrk6	UTSW	14	110749753	makesense	probably null
R5281:Slitrk6	UTSW	14	110750373	missense	probably damaging	1.00
R5450:Slitrk6	UTSW	14	110750097	missense	probably benign
R5579:Slitrk6	UTSW	14	110751217	missense	possibly damaging	0.82
R5689:Slitrk6	UTSW	14	110752126	missense	probably benign
R5935:Slitrk6	UTSW	14	110749873	missense	probably benign	0.00
R6016:Slitrk6	UTSW	14	110750526	missense	probably benign	0.00
R6312:Slitrk6	UTSW	14	110750247	missense	probably benign	0.00
R6890:Slitrk6	UTSW	14	110751096	nonsense	probably null
R6952:Slitrk6	UTSW	14	110750542	missense	probably benign
R7378:Slitrk6	UTSW	14	110749863	missense	probably damaging	1.00
R8354:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8401:Slitrk6	UTSW	14	110752021	missense	possibly damaging	0.67
R8454:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8807:Slitrk6	UTSW	14	110750691	missense	possibly damaging	0.77
R8814:Slitrk6	UTSW	14	110749938	missense	probably benign
R8826:Slitrk6	UTSW	14	110751369	missense	probably benign
R9681:Slitrk6	UTSW	14	110750826	missense	probably damaging	1.00
R9740:Slitrk6	UTSW	14	110749998	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCTTCCTTGGTCGTGAGTAC -3'
(R):5'- ATGAACAACACATGGTGAGCCC -3'

Sequencing Primer
(F):5'- CCTTGGTCGTGAGTACATCAACG -3'
(R):5'- GAGCCCAATGGTTCATGTCTACAG -3'

Posted On

2022-11-14