Incidental Mutation 'R9741:Olfr67'
ID 731833
Institutional Source Beutler Lab
Gene Symbol Olfr67
Ensembl Gene ENSMUSG00000047535
Gene Name olfactory receptor 67
Synonyms GA_x6K02T2PBJ9-6515150-6514170, 3'[b]1, MOR31-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9741 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103784594-103791821 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103787734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 181 (P181H)
Ref Sequence ENSEMBL: ENSMUSP00000138389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000183254]
AlphaFold F8VPJ8
Predicted Effect probably benign
Transcript: ENSMUST00000183254
AA Change: P181H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138389
Gene: ENSMUSG00000047535
AA Change: P181H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 41 231 5.5e-11 PFAM
Pfam:7tm_1 47 299 2.7e-30 PFAM
Pfam:7tm_4 146 292 1.7e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,770,624 I464T probably benign Het
Ankrd6 T A 4: 32,860,339 K35* probably null Het
Apoc3 G T 9: 46,234,700 T5K unknown Het
Arhgap20 T A 9: 51,849,430 Y860* probably null Het
Arhgef11 T C 3: 87,687,849 S123P probably benign Het
Axdnd1 T A 1: 156,341,815 Y827F probably benign Het
Bbs5 A G 2: 69,654,351 T122A probably benign Het
Btbd6 T A 12: 112,977,303 D173E probably benign Het
Cblb T C 16: 52,112,127 I149T probably damaging Het
Cyp2ab1 G A 16: 20,314,203 R214C probably damaging Het
Dbn1 C T 13: 55,476,301 S372N possibly damaging Het
Dlg1 T A 16: 31,857,917 Y776* probably null Het
Dock9 A T 14: 121,640,104 I409N probably damaging Het
Ect2 A T 3: 27,102,458 N815K probably benign Het
Fbxw11 G T 11: 32,735,358 V398L probably damaging Het
Gcsam T C 16: 45,615,956 F34S possibly damaging Het
Ghsr G A 3: 27,374,749 V308I possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm884 T C 11: 103,613,429 E2571G possibly damaging Het
H1fx A G 6: 87,981,218 Y47H probably damaging Het
Hspg2 T C 4: 137,512,651 F510S probably damaging Het
Htr1a T C 13: 105,445,353 V367A possibly damaging Het
Iars T G 13: 49,691,502 F163C probably damaging Het
Igfn1 T C 1: 135,967,645 T1728A probably benign Het
Ighv7-3 C T 12: 114,153,375 V56I probably benign Het
Lrp1b A T 2: 41,112,288 I2133N Het
Olfr715 A G 7: 107,129,159 V78A possibly damaging Het
Pkd1l1 T C 11: 8,947,224 T562A Het
Ppp1r10 G A 17: 35,926,439 R167Q possibly damaging Het
Ppp1r13l C T 7: 19,369,800 R69W probably damaging Het
Proser2 G A 2: 6,100,769 A328V probably benign Het
Rhou A G 8: 123,654,175 Y77C possibly damaging Het
Rprml T A 11: 103,650,031 L84Q probably damaging Het
Ryr3 C T 2: 112,646,926 C4515Y probably benign Het
Slc9a3 T A 13: 74,158,875 I373N possibly damaging Het
Snx21 C T 2: 164,792,311 A339V probably benign Het
Srpk1 G A 17: 28,599,678 P395S probably benign Het
Syt14 A T 1: 192,984,141 S152T unknown Het
Urb2 G T 8: 124,029,012 R486L probably damaging Het
Utrn T A 10: 12,826,820 M7L probably benign Het
Vmn2r59 T A 7: 42,058,785 D66V probably damaging Het
Znrf2 T C 6: 54,878,385 I197T probably damaging Het
Other mutations in Olfr67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Olfr67 APN 7 103787636 missense probably damaging 0.97
IGL01352:Olfr67 APN 7 103788078 nonsense probably null 0.00
IGL02318:Olfr67 APN 7 103788268 missense probably benign
R0413:Olfr67 UTSW 7 103788155 missense probably damaging 1.00
R0964:Olfr67 UTSW 7 103787397 missense probably benign 0.18
R2092:Olfr67 UTSW 7 103788072 missense possibly damaging 0.50
R3963:Olfr67 UTSW 7 103788034 missense probably benign 0.02
R4299:Olfr67 UTSW 7 103787995 missense probably benign 0.38
R4799:Olfr67 UTSW 7 103787481 missense possibly damaging 0.49
R5410:Olfr67 UTSW 7 103787374 missense probably damaging 0.97
R5959:Olfr67 UTSW 7 103787516 missense probably damaging 0.99
R6084:Olfr67 UTSW 7 103787955 missense probably benign 0.11
R6336:Olfr67 UTSW 7 103788245 missense possibly damaging 0.86
R7077:Olfr67 UTSW 7 103787386 missense probably damaging 0.99
R7453:Olfr67 UTSW 7 103787672 missense possibly damaging 0.90
R8695:Olfr67 UTSW 7 103787522 missense possibly damaging 0.81
R8753:Olfr67 UTSW 7 103787360 missense probably benign 0.08
R9062:Olfr67 UTSW 7 103787948 missense probably benign 0.00
R9126:Olfr67 UTSW 7 103787795 missense probably benign 0.27
R9784:Olfr67 UTSW 7 103787525 missense probably benign 0.02
Z1088:Olfr67 UTSW 7 103787365 missense probably damaging 0.99
Z1176:Olfr67 UTSW 7 103787453 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGGGAGCCACATGTGTTGAG -3'
(R):5'- ACATTTCATCTTTGTGGCAGAGTC -3'

Sequencing Primer
(F):5'- AGGGCCTTGTATCTGGCAGC -3'
(R):5'- AGAGTCTGCTATTCTTCTGGCCATG -3'
Posted On 2022-11-14