Mutagenetix > Incidental Mutation

Incidental Mutation 'R9742:Pik3c2b'

731861

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R9742 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133094749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1143 (E1143G)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably damaging
Transcript: ENSMUST00000077730
AA Change: E1143G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: E1143G

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	G	7: 79,099,367	S1295R	probably benign	Het
Acsf2	C	A	11: 94,573,137	V74L	probably benign	Het
Actrt3	T	C	3: 30,598,285	Y220C	probably damaging	Het
Adgrl2	A	G	3: 148,836,350		probably null	Het
Ak2	T	A	4: 129,008,168	D211E	possibly damaging	Het
Atp4b	G	A	8: 13,390,097	T83I	probably damaging	Het
Brat1	A	G	5: 140,718,157	T722A	probably benign	Het
Cfap65	T	C	1: 74,904,681	Y1557C	probably benign	Het
Cmya5	T	C	13: 93,095,427	D1051G	possibly damaging	Het
Cuedc2	A	G	19: 46,331,288		probably null	Het
Dtnb	A	T	12: 3,686,740	K293N	possibly damaging	Het
Dusp26	A	T	8: 31,094,170	T102S	probably benign	Het
Epg5	T	A	18: 77,980,955	L1079H	probably damaging	Het
Epha6	T	C	16: 60,205,702	Y459C	probably damaging	Het
Fam89b	A	T	19: 5,729,302	S76T	probably benign	Het
Fbxo33	A	G	12: 59,204,896	S278P	probably damaging	Het
Fndc3a	C	A	14: 72,540,253	E1171*	probably null	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Khdc1c	T	G	1: 21,369,721	H165Q	probably benign	Het
Ldb1	A	G	19: 46,035,419		probably null	Het
Lrrc27	C	T	7: 139,226,313	A298V	probably benign	Het
Lsr	CTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTC	7: 30,958,067		probably benign	Het
Mkl1	G	A	15: 81,016,979	A472V	possibly damaging	Het
Mpi	A	G	9: 57,545,323	C309R	probably damaging	Het
Muc3	A	G	5: 137,138,279	Y276H		Het
Myh6	T	A	14: 54,956,599	M778L	probably benign	Het
Nmnat1	T	A	4: 149,468,881	E258V	probably damaging	Het
Olfr1115	T	C	2: 87,252,032	F32L	probably benign	Het
Olfr1462	T	C	19: 13,191,405	V246A	probably damaging	Het
Plch2	C	T	4: 154,998,455	D579N	probably damaging	Het
Slc22a19	T	C	19: 7,710,916	Q93R	probably benign	Het
Slc9c1	T	A	16: 45,580,253	I742N	probably damaging	Het
Smarcc2	A	G	10: 128,461,353	Y38C	probably damaging	Het
Soga3	C	A	10: 29,148,398	Q437K	probably benign	Het
Strbp	T	C	2: 37,625,256	T253A	probably damaging	Het
Trim40	A	G	17: 36,889,010	S59P	possibly damaging	Het
Trpm6	G	T	19: 18,823,402	V827L	probably benign	Het
Unc5d	A	G	8: 28,666,764		probably null	Het
Vmn2r118	T	C	17: 55,611,009	T168A	probably damaging	Het
Wdfy4	G	A	14: 33,088,030	H1745Y		Het
Xrra1	A	G	7: 99,914,453	D549G	probably benign	Het
Zhx2	A	G	15: 57,823,410	E725G	probably benign	Het
Zzef1	G	A	11: 72,858,353	R889H	probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGCATGGTTTTCTGCCC -3'
(R):5'- TGGCTCATCTGTGCACATG -3'

Sequencing Primer
(F):5'- TGGTATATCCCTCCTAATAGCAGAC -3'
(R):5'- GCACATGCAGGTCTGGTG -3'

Posted On

2022-11-14