Incidental Mutation 'R9742:Slc9c1'
ID 731893
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R9742 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45400616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 742 (I742N)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: I742N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I742N

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T G 7: 78,749,115 (GRCm39) S1295R probably benign Het
Acsf2 C A 11: 94,463,963 (GRCm39) V74L probably benign Het
Actrt3 T C 3: 30,652,434 (GRCm39) Y220C probably damaging Het
Adgrl2 A G 3: 148,541,986 (GRCm39) probably null Het
Ak2 T A 4: 128,901,961 (GRCm39) D211E possibly damaging Het
Atp4b G A 8: 13,440,097 (GRCm39) T83I probably damaging Het
Brat1 A G 5: 140,703,912 (GRCm39) T722A probably benign Het
Cfap65 T C 1: 74,943,840 (GRCm39) Y1557C probably benign Het
Cmya5 T C 13: 93,231,935 (GRCm39) D1051G possibly damaging Het
Cuedc2 A G 19: 46,319,727 (GRCm39) probably null Het
Dtnb A T 12: 3,736,740 (GRCm39) K293N possibly damaging Het
Dusp26 A T 8: 31,584,198 (GRCm39) T102S probably benign Het
Epg5 T A 18: 78,024,170 (GRCm39) L1079H probably damaging Het
Epha6 T C 16: 60,026,065 (GRCm39) Y459C probably damaging Het
Fam89b A T 19: 5,779,330 (GRCm39) S76T probably benign Het
Fbxo33 A G 12: 59,251,682 (GRCm39) S278P probably damaging Het
Fndc3a C A 14: 72,777,693 (GRCm39) E1171* probably null Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Il17ra T A 6: 120,458,466 (GRCm39) I539N probably damaging Het
Khdc1c T G 1: 21,439,945 (GRCm39) H165Q probably benign Het
Ldb1 A G 19: 46,023,858 (GRCm39) probably null Het
Lrrc27 C T 7: 138,806,229 (GRCm39) A298V probably benign Het
Lsr CTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTC 7: 30,657,492 (GRCm39) probably benign Het
Mpi A G 9: 57,452,606 (GRCm39) C309R probably damaging Het
Mrtfa G A 15: 80,901,180 (GRCm39) A472V possibly damaging Het
Mtcl3 C A 10: 29,024,394 (GRCm39) Q437K probably benign Het
Muc17 A G 5: 137,167,127 (GRCm39) Y276H Het
Myh6 T A 14: 55,194,056 (GRCm39) M778L probably benign Het
Nmnat1 T A 4: 149,553,338 (GRCm39) E258V probably damaging Het
Or10ag53 T C 2: 87,082,376 (GRCm39) F32L probably benign Het
Or5b108 T C 19: 13,168,769 (GRCm39) V246A probably damaging Het
Pik3c2b A G 1: 133,022,487 (GRCm39) E1143G probably damaging Het
Plch2 C T 4: 155,082,912 (GRCm39) D579N probably damaging Het
Slc22a19 T C 19: 7,688,281 (GRCm39) Q93R probably benign Het
Smarcc2 A G 10: 128,297,222 (GRCm39) Y38C probably damaging Het
Strbp T C 2: 37,515,268 (GRCm39) T253A probably damaging Het
Trim40 A G 17: 37,199,902 (GRCm39) S59P possibly damaging Het
Trpm6 G T 19: 18,800,766 (GRCm39) V827L probably benign Het
Unc5d A G 8: 29,156,792 (GRCm39) probably null Het
Vmn2r118 T C 17: 55,918,009 (GRCm39) T168A probably damaging Het
Wdfy4 G A 14: 32,809,987 (GRCm39) H1745Y Het
Xrra1 A G 7: 99,563,660 (GRCm39) D549G probably benign Het
Zhx2 A G 15: 57,686,806 (GRCm39) E725G probably benign Het
Zzef1 G A 11: 72,749,179 (GRCm39) R889H probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTATCAACAGGTGGCAGCAATG -3'
(R):5'- TGAGTGCCTATAGCTCTGTGAG -3'

Sequencing Primer
(F):5'- CAGGTGGCAGCAATGAGGAAG -3'
(R):5'- TTAAACATCAGCCAGCCAG -3'
Posted On 2022-11-14