Incidental Mutation 'R9742:Slc9c1'
ID 731893
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock # R9742 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45535309-45607001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45580253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 742 (I742N)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: I742N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I742N

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T G 7: 79,099,367 S1295R probably benign Het
Acsf2 C A 11: 94,573,137 V74L probably benign Het
Actrt3 T C 3: 30,598,285 Y220C probably damaging Het
Adgrl2 A G 3: 148,836,350 probably null Het
Ak2 T A 4: 129,008,168 D211E possibly damaging Het
Atp4b G A 8: 13,390,097 T83I probably damaging Het
Brat1 A G 5: 140,718,157 T722A probably benign Het
Cfap65 T C 1: 74,904,681 Y1557C probably benign Het
Cmya5 T C 13: 93,095,427 D1051G possibly damaging Het
Cuedc2 A G 19: 46,331,288 probably null Het
Dtnb A T 12: 3,686,740 K293N possibly damaging Het
Dusp26 A T 8: 31,094,170 T102S probably benign Het
Epg5 T A 18: 77,980,955 L1079H probably damaging Het
Epha6 T C 16: 60,205,702 Y459C probably damaging Het
Fam89b A T 19: 5,729,302 S76T probably benign Het
Fbxo33 A G 12: 59,204,896 S278P probably damaging Het
Fndc3a C A 14: 72,540,253 E1171* probably null Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Khdc1c T G 1: 21,369,721 H165Q probably benign Het
Ldb1 A G 19: 46,035,419 probably null Het
Lrrc27 C T 7: 139,226,313 A298V probably benign Het
Lsr CTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTC 7: 30,958,067 probably benign Het
Mkl1 G A 15: 81,016,979 A472V possibly damaging Het
Mpi A G 9: 57,545,323 C309R probably damaging Het
Muc3 A G 5: 137,138,279 Y276H Het
Myh6 T A 14: 54,956,599 M778L probably benign Het
Nmnat1 T A 4: 149,468,881 E258V probably damaging Het
Olfr1115 T C 2: 87,252,032 F32L probably benign Het
Olfr1462 T C 19: 13,191,405 V246A probably damaging Het
Pik3c2b A G 1: 133,094,749 E1143G probably damaging Het
Plch2 C T 4: 154,998,455 D579N probably damaging Het
Slc22a19 T C 19: 7,710,916 Q93R probably benign Het
Smarcc2 A G 10: 128,461,353 Y38C probably damaging Het
Soga3 C A 10: 29,148,398 Q437K probably benign Het
Strbp T C 2: 37,625,256 T253A probably damaging Het
Trim40 A G 17: 36,889,010 S59P possibly damaging Het
Trpm6 G T 19: 18,823,402 V827L probably benign Het
Unc5d A G 8: 28,666,764 probably null Het
Vmn2r118 T C 17: 55,611,009 T168A probably damaging Het
Wdfy4 G A 14: 33,088,030 H1745Y Het
Xrra1 A G 7: 99,914,453 D549G probably benign Het
Zhx2 A G 15: 57,823,410 E725G probably benign Het
Zzef1 G A 11: 72,858,353 R889H probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45580127 missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45599781 missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45577912 missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45550188 missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45593485 missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45575407 missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45560342 missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45580214 missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45547663 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTATCAACAGGTGGCAGCAATG -3'
(R):5'- TGAGTGCCTATAGCTCTGTGAG -3'

Sequencing Primer
(F):5'- CAGGTGGCAGCAATGAGGAAG -3'
(R):5'- TTAAACATCAGCCAGCCAG -3'
Posted On 2022-11-14