Mutagenetix > Incidental Mutation

Incidental Mutation 'R9742:Vmn2r118'

731896

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R9742 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55611009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 168 (T168A)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

AlphaFold

E9Q1C1

Predicted Effect

probably damaging
Transcript: ENSMUST00000168440
AA Change: T168A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: T168A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	G	7: 79,099,367	S1295R	probably benign	Het
Acsf2	C	A	11: 94,573,137	V74L	probably benign	Het
Actrt3	T	C	3: 30,598,285	Y220C	probably damaging	Het
Adgrl2	A	G	3: 148,836,350		probably null	Het
Ak2	T	A	4: 129,008,168	D211E	possibly damaging	Het
Atp4b	G	A	8: 13,390,097	T83I	probably damaging	Het
Brat1	A	G	5: 140,718,157	T722A	probably benign	Het
Cfap65	T	C	1: 74,904,681	Y1557C	probably benign	Het
Cmya5	T	C	13: 93,095,427	D1051G	possibly damaging	Het
Cuedc2	A	G	19: 46,331,288		probably null	Het
Dtnb	A	T	12: 3,686,740	K293N	possibly damaging	Het
Dusp26	A	T	8: 31,094,170	T102S	probably benign	Het
Epg5	T	A	18: 77,980,955	L1079H	probably damaging	Het
Epha6	T	C	16: 60,205,702	Y459C	probably damaging	Het
Fam89b	A	T	19: 5,729,302	S76T	probably benign	Het
Fbxo33	A	G	12: 59,204,896	S278P	probably damaging	Het
Fndc3a	C	A	14: 72,540,253	E1171*	probably null	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Khdc1c	T	G	1: 21,369,721	H165Q	probably benign	Het
Ldb1	A	G	19: 46,035,419		probably null	Het
Lrrc27	C	T	7: 139,226,313	A298V	probably benign	Het
Lsr	CTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTC	7: 30,958,067		probably benign	Het
Mkl1	G	A	15: 81,016,979	A472V	possibly damaging	Het
Mpi	A	G	9: 57,545,323	C309R	probably damaging	Het
Muc3	A	G	5: 137,138,279	Y276H		Het
Myh6	T	A	14: 54,956,599	M778L	probably benign	Het
Nmnat1	T	A	4: 149,468,881	E258V	probably damaging	Het
Olfr1115	T	C	2: 87,252,032	F32L	probably benign	Het
Olfr1462	T	C	19: 13,191,405	V246A	probably damaging	Het
Pik3c2b	A	G	1: 133,094,749	E1143G	probably damaging	Het
Plch2	C	T	4: 154,998,455	D579N	probably damaging	Het
Slc22a19	T	C	19: 7,710,916	Q93R	probably benign	Het
Slc9c1	T	A	16: 45,580,253	I742N	probably damaging	Het
Smarcc2	A	G	10: 128,461,353	Y38C	probably damaging	Het
Soga3	C	A	10: 29,148,398	Q437K	probably benign	Het
Strbp	T	C	2: 37,625,256	T253A	probably damaging	Het
Trim40	A	G	17: 36,889,010	S59P	possibly damaging	Het
Trpm6	G	T	19: 18,823,402	V827L	probably benign	Het
Unc5d	A	G	8: 28,666,764		probably null	Het
Wdfy4	G	A	14: 33,088,030	H1745Y		Het
Xrra1	A	G	7: 99,914,453	D549G	probably benign	Het
Zhx2	A	G	15: 57,823,410	E725G	probably benign	Het
Zzef1	G	A	11: 72,858,353	R889H	probably benign	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8248:Vmn2r118	UTSW	17	55610936	missense	probably benign	0.18
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8428:Vmn2r118	UTSW	17	55608642	missense	probably benign	0.33
R8917:Vmn2r118	UTSW	17	55610216	missense	possibly damaging	0.82
R8993:Vmn2r118	UTSW	17	55610835	missense	possibly damaging	0.72
R9038:Vmn2r118	UTSW	17	55611649	missense	probably damaging	1.00
R9155:Vmn2r118	UTSW	17	55610207	missense	probably null	0.83
R9603:Vmn2r118	UTSW	17	55592837	missense	probably damaging	1.00
R9749:Vmn2r118	UTSW	17	55608415	critical splice donor site	probably null
R9792:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9793:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9795:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTAAACAGACTCCATTTCTTTGC -3'
(R):5'- GTCTAGAAGGCTTAAGTTGAACTCTAC -3'

Sequencing Primer
(F):5'- AAACAGACTCCATTTCTTTGCATTTC -3'
(R):5'- CTCTACATTTCCAGAGGATTATGGG -3'

Posted On

2022-11-14