Incidental Mutation 'R9743:Hfm1'
ID 731919
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # R9743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 106840192-106926321 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106874259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 974 (T974A)
Ref Sequence ENSEMBL: ENSMUSP00000108310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
AlphaFold D3Z4R1
Predicted Effect possibly damaging
Transcript: ENSMUST00000112690
AA Change: T974A

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: T974A

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117588
AA Change: T974A

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: T974A

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: T187A

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A C 19: 29,716,861 I1744S probably benign Het
Abl1 A G 2: 31,797,704 H571R probably benign Het
Adamts13 T C 2: 26,996,800 V983A probably benign Het
Adamts13 G A 2: 27,005,479 probably null Het
AI661453 T A 17: 47,469,315 N1181K unknown Het
Ank2 A T 3: 126,940,145 N605K possibly damaging Het
Armc2 T G 10: 41,922,602 K737T probably benign Het
Aspn A G 13: 49,551,674 Y4C probably benign Het
B3galt2 T C 1: 143,647,109 F328L probably benign Het
Ccl3 T C 11: 83,648,602 E52G probably damaging Het
Col5a1 C T 2: 27,974,493 A728V unknown Het
Cyp1b1 T A 17: 79,710,379 D449V probably benign Het
D130043K22Rik C T 13: 24,872,316 P544S probably damaging Het
Dgkd T A 1: 87,934,128 W28R Het
Emilin2 T C 17: 71,273,872 T620A probably benign Het
Ercc6 T G 14: 32,576,986 S1444A probably benign Het
Fam149b A G 14: 20,363,343 H264R probably benign Het
Fbxo7 T C 10: 86,047,909 V458A probably benign Het
Gria4 T G 9: 4,464,457 T502P probably damaging Het
Ifna16 T C 4: 88,676,693 D55G probably damaging Het
Lyst T C 13: 13,634,738 V331A possibly damaging Het
Mkks T C 2: 136,881,072 Y55C probably benign Het
Muc4 T C 16: 32,780,824 F1291L Het
Myo18a A G 11: 77,832,478 N1183S probably benign Het
Olfm2 T C 9: 20,668,489 D322G probably damaging Het
Olfr259 A G 2: 87,107,496 V297A probably damaging Het
Olfr435 A G 6: 43,202,295 Y217C probably benign Het
Olfr447 G A 6: 42,911,901 C126Y probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Pdik1l A T 4: 134,284,504 D9E probably benign Het
Pdzrn3 C A 6: 101,377,717 G58C probably damaging Het
Pex13 A T 11: 23,656,119 L37* probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Ptprq T A 10: 107,685,121 Y730F probably damaging Het
Rnase11 T A 14: 51,049,913 K61N probably benign Het
Setdb2 T C 14: 59,413,553 D427G probably benign Het
Slc22a21 A G 11: 53,951,749 V518A probably benign Het
Slf2 T C 19: 44,942,133 S550P probably benign Het
Supt16 T C 14: 52,171,482 R812G probably damaging Het
Taf4 C T 2: 179,939,799 V464M possibly damaging Het
Tas1r3 G A 4: 155,860,799 T655I probably damaging Het
Tg G A 15: 66,689,990 V1108I probably benign Het
Tmc7 C A 7: 118,551,229 R360S probably damaging Het
Tor3a T C 1: 156,673,533 T112A probably benign Het
Tsr3 T C 17: 25,241,700 L180P possibly damaging Het
Unc5d T C 8: 28,719,773 T512A possibly damaging Het
Vmn2r103 T A 17: 19,812,213 Y750N probably damaging Het
Vmn2r20 A T 6: 123,396,410 V491D probably damaging Het
Vmn2r52 T C 7: 10,170,679 E411G possibly damaging Het
Zfp760 T A 17: 21,723,357 S504R probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
R8739:Hfm1 UTSW 5 106898505 missense probably damaging 0.96
R8968:Hfm1 UTSW 5 106917573 missense probably benign 0.00
R9072:Hfm1 UTSW 5 106898280 missense probably benign 0.04
R9073:Hfm1 UTSW 5 106898280 missense probably benign 0.04
R9152:Hfm1 UTSW 5 106841745 missense probably benign 0.01
R9234:Hfm1 UTSW 5 106893468 missense probably benign
R9244:Hfm1 UTSW 5 106874900 missense probably damaging 0.96
R9576:Hfm1 UTSW 5 106874072 missense probably benign 0.00
R9649:Hfm1 UTSW 5 106918463 missense possibly damaging 0.82
R9782:Hfm1 UTSW 5 106874030 missense probably benign 0.38
R9789:Hfm1 UTSW 5 106917480 missense probably benign 0.00
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTATTTCTGCCTTGATATCACTG -3'
(R):5'- ATTCCAAACCCCAGTGTATAATGTC -3'

Sequencing Primer
(F):5'- GCCTTGATATCACTGTATCTTGC -3'
(R):5'- CTGAGGAATACACCCAGTGTTGATTG -3'
Posted On 2022-11-14