Mutagenetix > Incidental Mutation

Incidental Mutation 'R9743:Gria4'

731927

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R9743 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 4464457 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 502 (T502P)

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000027020
AA Change: T502P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: T502P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000063508
AA Change: T502P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: T502P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212533
AA Change: T502P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	C	19: 29,716,861	I1744S	probably benign	Het
Abl1	A	G	2: 31,797,704	H571R	probably benign	Het
Adamts13	T	C	2: 26,996,800	V983A	probably benign	Het
Adamts13	G	A	2: 27,005,479		probably null	Het
AI661453	T	A	17: 47,469,315	N1181K	unknown	Het
Ank2	A	T	3: 126,940,145	N605K	possibly damaging	Het
Armc2	T	G	10: 41,922,602	K737T	probably benign	Het
Aspn	A	G	13: 49,551,674	Y4C	probably benign	Het
B3galt2	T	C	1: 143,647,109	F328L	probably benign	Het
Ccl3	T	C	11: 83,648,602	E52G	probably damaging	Het
Col5a1	C	T	2: 27,974,493	A728V	unknown	Het
Cyp1b1	T	A	17: 79,710,379	D449V	probably benign	Het
D130043K22Rik	C	T	13: 24,872,316	P544S	probably damaging	Het
Dgkd	T	A	1: 87,934,128	W28R		Het
Emilin2	T	C	17: 71,273,872	T620A	probably benign	Het
Ercc6	T	G	14: 32,576,986	S1444A	probably benign	Het
Fam149b	A	G	14: 20,363,343	H264R	probably benign	Het
Fbxo7	T	C	10: 86,047,909	V458A	probably benign	Het
Hfm1	T	C	5: 106,874,259	T974A	possibly damaging	Het
Ifna16	T	C	4: 88,676,693	D55G	probably damaging	Het
Lyst	T	C	13: 13,634,738	V331A	possibly damaging	Het
Mkks	T	C	2: 136,881,072	Y55C	probably benign	Het
Muc4	T	C	16: 32,780,824	F1291L		Het
Myo18a	A	G	11: 77,832,478	N1183S	probably benign	Het
Olfm2	T	C	9: 20,668,489	D322G	probably damaging	Het
Olfr259	A	G	2: 87,107,496	V297A	probably damaging	Het
Olfr435	A	G	6: 43,202,295	Y217C	probably benign	Het
Olfr447	G	A	6: 42,911,901	C126Y	probably damaging	Het
Olfr871	A	G	9: 20,212,544	N65S	probably damaging	Het
Pdik1l	A	T	4: 134,284,504	D9E	probably benign	Het
Pdzrn3	C	A	6: 101,377,717	G58C	probably damaging	Het
Pex13	A	T	11: 23,656,119	L37*	probably null	Het
Pigr	G	A	1: 130,841,803	R117Q	possibly damaging	Het
Ptprq	T	A	10: 107,685,121	Y730F	probably damaging	Het
Rnase11	T	A	14: 51,049,913	K61N	probably benign	Het
Setdb2	T	C	14: 59,413,553	D427G	probably benign	Het
Slc22a21	A	G	11: 53,951,749	V518A	probably benign	Het
Slf2	T	C	19: 44,942,133	S550P	probably benign	Het
Supt16	T	C	14: 52,171,482	R812G	probably damaging	Het
Taf4	C	T	2: 179,939,799	V464M	possibly damaging	Het
Tas1r3	G	A	4: 155,860,799	T655I	probably damaging	Het
Tg	G	A	15: 66,689,990	V1108I	probably benign	Het
Tmc7	C	A	7: 118,551,229	R360S	probably damaging	Het
Tor3a	T	C	1: 156,673,533	T112A	probably benign	Het
Tsr3	T	C	17: 25,241,700	L180P	possibly damaging	Het
Unc5d	T	C	8: 28,719,773	T512A	possibly damaging	Het
Vmn2r103	T	A	17: 19,812,213	Y750N	probably damaging	Het
Vmn2r20	A	T	6: 123,396,410	V491D	probably damaging	Het
Vmn2r52	T	C	7: 10,170,679	E411G	possibly damaging	Het
Zfp760	T	A	17: 21,723,357	S504R	probably benign	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CACGCTGACACCAATGTATGC -3'
(R):5'- GGAATTCTGTCTGTCTCCAAGAAATG -3'

Sequencing Primer
(F):5'- TGTATGCAAACACTATGCACATC -3'
(R):5'- TCTCATGAGACAAAACCACTACATG -3'

Posted On

2022-11-14