Mutagenetix > Incidental Mutation

Incidental Mutation 'R9743:Setdb2'

731944

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.562) question?

Stock #

R9743 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59413553 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 427 (D427G)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably benign
Transcript: ENSMUST00000095775
AA Change: D443G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: D443G

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161459
AA Change: D427G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: D427G

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	C	19: 29,716,861	I1744S	probably benign	Het
Abl1	A	G	2: 31,797,704	H571R	probably benign	Het
Adamts13	T	C	2: 26,996,800	V983A	probably benign	Het
Adamts13	G	A	2: 27,005,479		probably null	Het
AI661453	T	A	17: 47,469,315	N1181K	unknown	Het
Ank2	A	T	3: 126,940,145	N605K	possibly damaging	Het
Armc2	T	G	10: 41,922,602	K737T	probably benign	Het
Aspn	A	G	13: 49,551,674	Y4C	probably benign	Het
B3galt2	T	C	1: 143,647,109	F328L	probably benign	Het
Ccl3	T	C	11: 83,648,602	E52G	probably damaging	Het
Col5a1	C	T	2: 27,974,493	A728V	unknown	Het
Cyp1b1	T	A	17: 79,710,379	D449V	probably benign	Het
D130043K22Rik	C	T	13: 24,872,316	P544S	probably damaging	Het
Dgkd	T	A	1: 87,934,128	W28R		Het
Emilin2	T	C	17: 71,273,872	T620A	probably benign	Het
Ercc6	T	G	14: 32,576,986	S1444A	probably benign	Het
Fam149b	A	G	14: 20,363,343	H264R	probably benign	Het
Fbxo7	T	C	10: 86,047,909	V458A	probably benign	Het
Gria4	T	G	9: 4,464,457	T502P	probably damaging	Het
Hfm1	T	C	5: 106,874,259	T974A	possibly damaging	Het
Ifna16	T	C	4: 88,676,693	D55G	probably damaging	Het
Lyst	T	C	13: 13,634,738	V331A	possibly damaging	Het
Mkks	T	C	2: 136,881,072	Y55C	probably benign	Het
Muc4	T	C	16: 32,780,824	F1291L		Het
Myo18a	A	G	11: 77,832,478	N1183S	probably benign	Het
Olfm2	T	C	9: 20,668,489	D322G	probably damaging	Het
Olfr259	A	G	2: 87,107,496	V297A	probably damaging	Het
Olfr435	A	G	6: 43,202,295	Y217C	probably benign	Het
Olfr447	G	A	6: 42,911,901	C126Y	probably damaging	Het
Olfr871	A	G	9: 20,212,544	N65S	probably damaging	Het
Pdik1l	A	T	4: 134,284,504	D9E	probably benign	Het
Pdzrn3	C	A	6: 101,377,717	G58C	probably damaging	Het
Pex13	A	T	11: 23,656,119	L37*	probably null	Het
Pigr	G	A	1: 130,841,803	R117Q	possibly damaging	Het
Ptprq	T	A	10: 107,685,121	Y730F	probably damaging	Het
Rnase11	T	A	14: 51,049,913	K61N	probably benign	Het
Slc22a21	A	G	11: 53,951,749	V518A	probably benign	Het
Slf2	T	C	19: 44,942,133	S550P	probably benign	Het
Supt16	T	C	14: 52,171,482	R812G	probably damaging	Het
Taf4	C	T	2: 179,939,799	V464M	possibly damaging	Het
Tas1r3	G	A	4: 155,860,799	T655I	probably damaging	Het
Tg	G	A	15: 66,689,990	V1108I	probably benign	Het
Tmc7	C	A	7: 118,551,229	R360S	probably damaging	Het
Tor3a	T	C	1: 156,673,533	T112A	probably benign	Het
Tsr3	T	C	17: 25,241,700	L180P	possibly damaging	Het
Unc5d	T	C	8: 28,719,773	T512A	possibly damaging	Het
Vmn2r103	T	A	17: 19,812,213	Y750N	probably damaging	Het
Vmn2r20	A	T	6: 123,396,410	V491D	probably damaging	Het
Vmn2r52	T	C	7: 10,170,679	E411G	possibly damaging	Het
Zfp760	T	A	17: 21,723,357	S504R	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCGCTGGCTAGTTATTAAGG -3'
(R):5'- CAGATGCCTACTTGTTGGTAGC -3'

Sequencing Primer
(F):5'- GGTAAGAATGCTGGATTTCTACAAG -3'
(R):5'- GGTAGCTTCCTGTTTTGAACAC -3'

Posted On

2022-11-14