Incidental Mutation 'R9743:Vmn2r103'
ID 731947
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20032475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 750 (Y750N)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: Y750N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: Y750N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 A G 2: 31,687,716 (GRCm39) H571R probably benign Het
Adamts13 T C 2: 26,886,812 (GRCm39) V983A probably benign Het
Adamts13 G A 2: 26,895,491 (GRCm39) probably null Het
AI661453 T A 17: 47,780,240 (GRCm39) N1181K unknown Het
Ank2 A T 3: 126,733,794 (GRCm39) N605K possibly damaging Het
Armc2 T G 10: 41,798,598 (GRCm39) K737T probably benign Het
Aspn A G 13: 49,705,150 (GRCm39) Y4C probably benign Het
B3galt2 T C 1: 143,522,847 (GRCm39) F328L probably benign Het
Brd10 A C 19: 29,694,261 (GRCm39) I1744S probably benign Het
Ccl3 T C 11: 83,539,428 (GRCm39) E52G probably damaging Het
Col5a1 C T 2: 27,864,505 (GRCm39) A728V unknown Het
Cyp1b1 T A 17: 80,017,808 (GRCm39) D449V probably benign Het
D130043K22Rik C T 13: 25,056,299 (GRCm39) P544S probably damaging Het
Dgkd T A 1: 87,861,850 (GRCm39) W28R Het
Emilin2 T C 17: 71,580,867 (GRCm39) T620A probably benign Het
Ercc6 T G 14: 32,298,943 (GRCm39) S1444A probably benign Het
Fam149b A G 14: 20,413,411 (GRCm39) H264R probably benign Het
Fbxo7 T C 10: 85,883,773 (GRCm39) V458A probably benign Het
Gria4 T G 9: 4,464,457 (GRCm39) T502P probably damaging Het
Hfm1 T C 5: 107,022,125 (GRCm39) T974A possibly damaging Het
Ifna16 T C 4: 88,594,930 (GRCm39) D55G probably damaging Het
Lyst T C 13: 13,809,323 (GRCm39) V331A possibly damaging Het
Mkks T C 2: 136,722,992 (GRCm39) Y55C probably benign Het
Muc4 T C 16: 32,601,194 (GRCm39) F1291L Het
Myo18a A G 11: 77,723,304 (GRCm39) N1183S probably benign Het
Olfm2 T C 9: 20,579,785 (GRCm39) D322G probably damaging Het
Or2a25 G A 6: 42,888,835 (GRCm39) C126Y probably damaging Het
Or2a51 A G 6: 43,179,229 (GRCm39) Y217C probably benign Het
Or5aq7 A G 2: 86,937,840 (GRCm39) V297A probably damaging Het
Or7h8 A G 9: 20,123,840 (GRCm39) N65S probably damaging Het
Pdik1l A T 4: 134,011,815 (GRCm39) D9E probably benign Het
Pdzrn3 C A 6: 101,354,678 (GRCm39) G58C probably damaging Het
Pex13 A T 11: 23,606,119 (GRCm39) L37* probably null Het
Pigr G A 1: 130,769,540 (GRCm39) R117Q possibly damaging Het
Ptprq T A 10: 107,520,982 (GRCm39) Y730F probably damaging Het
Rnase11 T A 14: 51,287,370 (GRCm39) K61N probably benign Het
Setdb2 T C 14: 59,651,002 (GRCm39) D427G probably benign Het
Slc22a21 A G 11: 53,842,575 (GRCm39) V518A probably benign Het
Slf2 T C 19: 44,930,572 (GRCm39) S550P probably benign Het
Supt16 T C 14: 52,408,939 (GRCm39) R812G probably damaging Het
Taf4 C T 2: 179,581,592 (GRCm39) V464M possibly damaging Het
Tas1r3 G A 4: 155,945,256 (GRCm39) T655I probably damaging Het
Tg G A 15: 66,561,839 (GRCm39) V1108I probably benign Het
Tmc7 C A 7: 118,150,452 (GRCm39) R360S probably damaging Het
Tor3a T C 1: 156,501,103 (GRCm39) T112A probably benign Het
Tsr3 T C 17: 25,460,674 (GRCm39) L180P possibly damaging Het
Unc5d T C 8: 29,209,801 (GRCm39) T512A possibly damaging Het
Vmn2r20 A T 6: 123,373,369 (GRCm39) V491D probably damaging Het
Vmn2r52 T C 7: 9,904,606 (GRCm39) E411G possibly damaging Het
Zfp760 T A 17: 21,942,338 (GRCm39) S504R probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGGGGTCCAAACTACATCATTCC -3'
(R):5'- TGGGACCAAATATGAAGGCC -3'

Sequencing Primer
(F):5'- GTCCAAACTACATCATTCCTATATGC -3'
(R):5'- AGTGCTATGCTGGAAGCC -3'
Posted On 2022-11-14