Incidental Mutation 'R9743:Vmn2r103'
ID 731947
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19773363-19812536 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19812213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 750 (Y750N)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: Y750N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: Y750N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A C 19: 29,716,861 I1744S probably benign Het
Abl1 A G 2: 31,797,704 H571R probably benign Het
Adamts13 T C 2: 26,996,800 V983A probably benign Het
Adamts13 G A 2: 27,005,479 probably null Het
AI661453 T A 17: 47,469,315 N1181K unknown Het
Ank2 A T 3: 126,940,145 N605K possibly damaging Het
Armc2 T G 10: 41,922,602 K737T probably benign Het
Aspn A G 13: 49,551,674 Y4C probably benign Het
B3galt2 T C 1: 143,647,109 F328L probably benign Het
Ccl3 T C 11: 83,648,602 E52G probably damaging Het
Col5a1 C T 2: 27,974,493 A728V unknown Het
Cyp1b1 T A 17: 79,710,379 D449V probably benign Het
D130043K22Rik C T 13: 24,872,316 P544S probably damaging Het
Dgkd T A 1: 87,934,128 W28R Het
Emilin2 T C 17: 71,273,872 T620A probably benign Het
Ercc6 T G 14: 32,576,986 S1444A probably benign Het
Fam149b A G 14: 20,363,343 H264R probably benign Het
Fbxo7 T C 10: 86,047,909 V458A probably benign Het
Gria4 T G 9: 4,464,457 T502P probably damaging Het
Hfm1 T C 5: 106,874,259 T974A possibly damaging Het
Ifna16 T C 4: 88,676,693 D55G probably damaging Het
Lyst T C 13: 13,634,738 V331A possibly damaging Het
Mkks T C 2: 136,881,072 Y55C probably benign Het
Muc4 T C 16: 32,780,824 F1291L Het
Myo18a A G 11: 77,832,478 N1183S probably benign Het
Olfm2 T C 9: 20,668,489 D322G probably damaging Het
Olfr259 A G 2: 87,107,496 V297A probably damaging Het
Olfr435 A G 6: 43,202,295 Y217C probably benign Het
Olfr447 G A 6: 42,911,901 C126Y probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Pdik1l A T 4: 134,284,504 D9E probably benign Het
Pdzrn3 C A 6: 101,377,717 G58C probably damaging Het
Pex13 A T 11: 23,656,119 L37* probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Ptprq T A 10: 107,685,121 Y730F probably damaging Het
Rnase11 T A 14: 51,049,913 K61N probably benign Het
Setdb2 T C 14: 59,413,553 D427G probably benign Het
Slc22a21 A G 11: 53,951,749 V518A probably benign Het
Slf2 T C 19: 44,942,133 S550P probably benign Het
Supt16 T C 14: 52,171,482 R812G probably damaging Het
Taf4 C T 2: 179,939,799 V464M possibly damaging Het
Tas1r3 G A 4: 155,860,799 T655I probably damaging Het
Tg G A 15: 66,689,990 V1108I probably benign Het
Tmc7 C A 7: 118,551,229 R360S probably damaging Het
Tor3a T C 1: 156,673,533 T112A probably benign Het
Tsr3 T C 17: 25,241,700 L180P possibly damaging Het
Unc5d T C 8: 28,719,773 T512A possibly damaging Het
Vmn2r20 A T 6: 123,396,410 V491D probably damaging Het
Vmn2r52 T C 7: 10,170,679 E411G possibly damaging Het
Zfp760 T A 17: 21,723,357 S504R probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 19793497 missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 19811796 missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 19811943 missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 19812384 missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 19811896 missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 19811659 missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 19793765 missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 19799263 nonsense probably null
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGGGGTCCAAACTACATCATTCC -3'
(R):5'- TGGGACCAAATATGAAGGCC -3'

Sequencing Primer
(F):5'- GTCCAAACTACATCATTCCTATATGC -3'
(R):5'- AGTGCTATGCTGGAAGCC -3'
Posted On 2022-11-14