Incidental Mutation 'R9744:Itih5'
ID 731957
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9744 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10251410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 896 (Y896H)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably damaging
Transcript: ENSMUST00000026886
AA Change: Y896H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: Y896H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,505,134 M677L probably benign Het
Ankrd24 T G 10: 81,647,117 D966E possibly damaging Het
Arhgef28 A G 13: 97,957,753 L961P probably damaging Het
Atxn1 G A 13: 45,567,823 Q199* probably null Het
Bcl2a1c G A 9: 114,330,273 V40I probably benign Het
Cep41 A G 6: 30,656,604 V283A probably benign Het
Cerk A G 15: 86,149,290 Y311H probably damaging Het
Ciz1 A T 2: 32,363,847 Q13L unknown Het
Cpeb2 T C 5: 43,233,925 S155P Het
Dmbx1 T A 4: 115,920,065 E200D probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Erc1 T C 6: 119,743,399 Y747C probably damaging Het
Fhad1 T C 4: 141,909,813 E1114G probably damaging Het
Fndc3a C A 14: 72,540,253 E1171* probably null Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gys2 A C 6: 142,448,461 D450E probably benign Het
Hmcn1 A T 1: 150,748,190 I1120N probably damaging Het
Ints3 G T 3: 90,411,298 T210K probably damaging Het
Kcna7 A G 7: 45,406,978 D206G probably benign Het
Klhl10 T A 11: 100,445,570 C128S probably damaging Het
Klhl5 T C 5: 65,162,912 V603A probably damaging Het
Mapk15 T A 15: 75,998,063 I344N possibly damaging Het
Mdn1 T C 4: 32,715,711 F1993L possibly damaging Het
Myo1c T C 11: 75,671,971 L959P probably damaging Het
Nectin1 A G 9: 43,803,943 Q492R probably damaging Het
Nlrp14 A T 7: 107,197,780 L951F probably damaging Het
Nlrp5 T G 7: 23,421,477 S705R possibly damaging Het
Nlrp9a A G 7: 26,567,841 Y787C probably benign Het
Npsr1 A G 9: 24,289,886 T189A probably benign Het
Nup205 T C 6: 35,232,575 Y1606H probably damaging Het
Olfr1298 C A 2: 111,645,319 R226L probably benign Het
Olfr1346 A T 7: 6,474,211 I34L probably benign Het
Olfr1362 A G 13: 21,611,657 F104S possibly damaging Het
Pitx2 A T 3: 129,215,818 T129S probably damaging Het
Pla2g2c T C 4: 138,743,661 S118P probably damaging Het
Polr1a A G 6: 71,929,388 N396S probably benign Het
Prl A T 13: 27,064,355 Q135L probably benign Het
Prrc2c A G 1: 162,678,164 L2555P possibly damaging Het
Psg29 A T 7: 17,210,570 D335V probably benign Het
Psme4 T C 11: 30,815,294 probably null Het
Ramp2 T A 11: 101,247,087 S52T unknown Het
Skint6 C T 4: 112,809,163 G1155D probably damaging Het
Sorcs1 G A 19: 50,226,837 R655C probably damaging Het
Syne1 A G 10: 5,324,184 C1867R probably benign Het
Tcf21 T C 10: 22,819,827 D26G probably benign Het
Tmem132a G A 19: 10,863,314 P418L probably damaging Het
Tob1 C T 11: 94,214,228 R197C probably damaging Het
Vmn2r110 A G 17: 20,574,586 V607A probably damaging Het
Vmn2r30 A G 7: 7,312,285 S850P possibly damaging Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCTCTCTGCGTTCAAC -3'
(R):5'- GTCCAGAGTAGACCCAATATCC -3'

Sequencing Primer
(F):5'- GCTCTCTGCGTTCAACTTATATCAG -3'
(R):5'- GAGTAGACCCAATATCCCTTCC -3'
Posted On 2022-11-14