Incidental Mutation 'R9745:Eif5b'
ID 732006
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Name eukaryotic translation initiation factor 5B
Synonyms IF2, A030003E17Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 38037091-38094660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38084729 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 859 (V859F)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252]
AlphaFold Q05D44
Predicted Effect probably damaging
Transcript: ENSMUST00000027252
AA Change: V859F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: V859F

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38,080,800 (GRCm39) missense probably damaging 1.00
IGL01377:Eif5b APN 1 38,075,179 (GRCm39) missense probably benign
IGL01395:Eif5b APN 1 38,076,339 (GRCm39) missense probably damaging 0.96
IGL01572:Eif5b APN 1 38,061,335 (GRCm39) nonsense probably null
IGL01615:Eif5b APN 1 38,084,787 (GRCm39) missense probably damaging 1.00
IGL02141:Eif5b APN 1 38,071,403 (GRCm39) missense probably benign 0.09
IGL02260:Eif5b APN 1 38,084,537 (GRCm39) missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38,080,828 (GRCm39) missense probably damaging 1.00
IGL03180:Eif5b APN 1 38,075,350 (GRCm39) missense probably damaging 1.00
IGL03327:Eif5b APN 1 38,080,772 (GRCm39) splice site probably benign
R0018:Eif5b UTSW 1 38,057,970 (GRCm39) missense unknown
R0036:Eif5b UTSW 1 38,058,192 (GRCm39) missense probably benign 0.23
R0137:Eif5b UTSW 1 38,058,324 (GRCm39) missense probably benign 0.23
R0349:Eif5b UTSW 1 38,071,447 (GRCm39) missense probably benign 0.18
R0606:Eif5b UTSW 1 38,087,974 (GRCm39) missense probably damaging 1.00
R1056:Eif5b UTSW 1 38,061,248 (GRCm39) missense unknown
R1225:Eif5b UTSW 1 38,076,709 (GRCm39) missense probably damaging 1.00
R2043:Eif5b UTSW 1 38,080,900 (GRCm39) missense probably damaging 1.00
R2163:Eif5b UTSW 1 38,087,875 (GRCm39) missense probably benign 0.32
R2225:Eif5b UTSW 1 38,058,304 (GRCm39) missense unknown
R2432:Eif5b UTSW 1 38,058,423 (GRCm39) missense unknown
R2922:Eif5b UTSW 1 38,057,100 (GRCm39) splice site probably benign
R4357:Eif5b UTSW 1 38,089,339 (GRCm39) missense probably damaging 1.00
R4631:Eif5b UTSW 1 38,080,828 (GRCm39) missense probably damaging 1.00
R4665:Eif5b UTSW 1 38,084,793 (GRCm39) missense probably damaging 1.00
R4702:Eif5b UTSW 1 38,057,958 (GRCm39) missense unknown
R4941:Eif5b UTSW 1 38,090,280 (GRCm39) missense probably damaging 1.00
R4995:Eif5b UTSW 1 38,090,792 (GRCm39) makesense probably null
R5020:Eif5b UTSW 1 38,058,150 (GRCm39) nonsense probably null
R5175:Eif5b UTSW 1 38,084,468 (GRCm39) missense probably damaging 1.00
R5375:Eif5b UTSW 1 38,084,835 (GRCm39) missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38,090,328 (GRCm39) missense probably damaging 1.00
R5566:Eif5b UTSW 1 38,084,765 (GRCm39) missense possibly damaging 0.90
R5853:Eif5b UTSW 1 38,076,388 (GRCm39) missense probably damaging 1.00
R5978:Eif5b UTSW 1 38,037,361 (GRCm39) splice site probably null
R6315:Eif5b UTSW 1 38,057,114 (GRCm39) missense unknown
R6376:Eif5b UTSW 1 38,084,760 (GRCm39) missense probably damaging 0.98
R6388:Eif5b UTSW 1 38,058,081 (GRCm39) missense unknown
R6444:Eif5b UTSW 1 38,075,292 (GRCm39) missense probably damaging 1.00
R6455:Eif5b UTSW 1 38,058,108 (GRCm39) missense probably benign 0.23
R6810:Eif5b UTSW 1 38,085,741 (GRCm39) missense probably benign 0.45
R6877:Eif5b UTSW 1 38,089,320 (GRCm39) missense probably damaging 1.00
R7130:Eif5b UTSW 1 38,080,857 (GRCm39) missense probably damaging 1.00
R7180:Eif5b UTSW 1 38,088,155 (GRCm39) missense probably damaging 0.98
R7439:Eif5b UTSW 1 38,090,718 (GRCm39) missense probably benign 0.28
R7488:Eif5b UTSW 1 38,089,387 (GRCm39) missense possibly damaging 0.69
R8140:Eif5b UTSW 1 38,090,357 (GRCm39) missense probably benign 0.41
R8166:Eif5b UTSW 1 38,087,901 (GRCm39) missense probably benign 0.11
R8191:Eif5b UTSW 1 38,075,283 (GRCm39) missense probably damaging 0.98
R8304:Eif5b UTSW 1 38,084,774 (GRCm39) missense probably benign 0.11
R8549:Eif5b UTSW 1 38,076,288 (GRCm39) missense possibly damaging 0.96
R8558:Eif5b UTSW 1 38,083,795 (GRCm39) missense probably damaging 0.99
R8893:Eif5b UTSW 1 38,090,300 (GRCm39) missense possibly damaging 0.48
R9452:Eif5b UTSW 1 38,084,861 (GRCm39) missense probably damaging 1.00
R9487:Eif5b UTSW 1 38,084,560 (GRCm39) missense probably damaging 0.99
R9487:Eif5b UTSW 1 38,058,451 (GRCm39) nonsense probably null
R9542:Eif5b UTSW 1 38,057,131 (GRCm39) nonsense probably null
R9721:Eif5b UTSW 1 38,076,740 (GRCm39) critical splice donor site probably null
R9748:Eif5b UTSW 1 38,090,241 (GRCm39) missense possibly damaging 0.89
RF018:Eif5b UTSW 1 38,060,673 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCATGTTGAGCAAGAGGC -3'
(R):5'- AGCATTGTGTCGTCCTCATG -3'

Sequencing Primer
(F):5'- CTTGCACACTGTGAAGAGCTG -3'
(R):5'- GTGTCGTCCTCATGTCCACAC -3'
Posted On 2022-11-14