Incidental Mutation 'R9745:Disp1'
ID 732008
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Name dispatched RND transporter family member 1
Synonyms DispA, 1190008H24Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 182867830-183003086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 182869310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1037 (S1037A)
Ref Sequence ENSEMBL: ENSMUSP00000003035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
AlphaFold Q3TDN0
Predicted Effect probably damaging
Transcript: ENSMUST00000003035
AA Change: S1037A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: S1037A

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171366
AA Change: S1037A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: S1037A

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195372
AA Change: S1037A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: S1037A

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB006:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
BB016:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R1120:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably benign 0.24
R1482:Disp1 UTSW 1 182,868,038 (GRCm39) missense possibly damaging 0.61
R1655:Disp1 UTSW 1 182,868,568 (GRCm39) missense probably benign 0.01
R1660:Disp1 UTSW 1 182,869,306 (GRCm39) missense probably damaging 1.00
R1816:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably damaging 0.99
R1835:Disp1 UTSW 1 182,870,564 (GRCm39) missense probably damaging 1.00
R1954:Disp1 UTSW 1 182,870,107 (GRCm39) missense probably damaging 0.99
R2025:Disp1 UTSW 1 182,869,767 (GRCm39) missense probably damaging 1.00
R2136:Disp1 UTSW 1 182,869,942 (GRCm39) missense probably damaging 1.00
R2150:Disp1 UTSW 1 182,869,936 (GRCm39) missense probably damaging 1.00
R2207:Disp1 UTSW 1 182,869,906 (GRCm39) missense possibly damaging 0.94
R2392:Disp1 UTSW 1 182,868,731 (GRCm39) missense probably benign
R2831:Disp1 UTSW 1 182,870,883 (GRCm39) small deletion probably benign
R3111:Disp1 UTSW 1 182,869,087 (GRCm39) missense probably damaging 1.00
R3116:Disp1 UTSW 1 182,870,486 (GRCm39) missense probably benign 0.01
R3160:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3161:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3716:Disp1 UTSW 1 182,869,315 (GRCm39) missense probably damaging 1.00
R3914:Disp1 UTSW 1 182,870,666 (GRCm39) missense probably benign 0.05
R4061:Disp1 UTSW 1 182,869,264 (GRCm39) missense probably damaging 0.96
R4191:Disp1 UTSW 1 182,870,737 (GRCm39) missense probably damaging 1.00
R4261:Disp1 UTSW 1 182,870,950 (GRCm39) missense probably damaging 1.00
R4272:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4273:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4351:Disp1 UTSW 1 182,881,542 (GRCm39) missense probably benign 0.01
R4672:Disp1 UTSW 1 182,880,215 (GRCm39) critical splice acceptor site probably null
R4764:Disp1 UTSW 1 182,869,660 (GRCm39) missense probably damaging 1.00
R4910:Disp1 UTSW 1 182,917,027 (GRCm39) missense probably damaging 1.00
R5150:Disp1 UTSW 1 182,871,063 (GRCm39) missense probably damaging 0.98
R5502:Disp1 UTSW 1 182,869,450 (GRCm39) missense probably damaging 1.00
R5616:Disp1 UTSW 1 182,869,913 (GRCm39) missense probably benign 0.30
R5699:Disp1 UTSW 1 182,870,119 (GRCm39) nonsense probably null
R5813:Disp1 UTSW 1 182,869,974 (GRCm39) missense probably damaging 1.00
R5820:Disp1 UTSW 1 182,917,151 (GRCm39) missense probably benign 0.00
R6184:Disp1 UTSW 1 182,867,896 (GRCm39) missense probably benign 0.00
R6228:Disp1 UTSW 1 182,880,589 (GRCm39) missense possibly damaging 0.59
R6306:Disp1 UTSW 1 182,868,712 (GRCm39) missense possibly damaging 0.93
R6505:Disp1 UTSW 1 182,868,076 (GRCm39) missense probably benign 0.02
R6925:Disp1 UTSW 1 182,868,042 (GRCm39) missense probably benign
R7016:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7045:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7046:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7047:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7114:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7123:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7124:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7125:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7161:Disp1 UTSW 1 182,869,189 (GRCm39) missense possibly damaging 0.84
R7510:Disp1 UTSW 1 182,869,975 (GRCm39) missense probably damaging 1.00
R7756:Disp1 UTSW 1 182,871,298 (GRCm39) missense probably damaging 1.00
R7800:Disp1 UTSW 1 182,880,550 (GRCm39) missense probably benign 0.00
R7929:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R8029:Disp1 UTSW 1 182,870,852 (GRCm39) missense probably damaging 1.00
R8036:Disp1 UTSW 1 182,870,803 (GRCm39) missense probably damaging 1.00
R8045:Disp1 UTSW 1 182,870,794 (GRCm39) missense probably damaging 1.00
R8054:Disp1 UTSW 1 182,869,812 (GRCm39) nonsense probably null
R8061:Disp1 UTSW 1 182,869,151 (GRCm39) missense probably damaging 1.00
R8094:Disp1 UTSW 1 182,869,192 (GRCm39) missense probably damaging 1.00
R8130:Disp1 UTSW 1 182,917,199 (GRCm39) missense probably benign 0.13
R8731:Disp1 UTSW 1 182,869,072 (GRCm39) missense possibly damaging 0.65
R9076:Disp1 UTSW 1 182,868,799 (GRCm39) missense possibly damaging 0.59
R9490:Disp1 UTSW 1 182,871,092 (GRCm39) missense probably benign 0.03
R9712:Disp1 UTSW 1 182,917,379 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGAGCATCATGAACGTGCC -3'
(R):5'- TTCTACGACCTGCAGGACAG -3'

Sequencing Primer
(F):5'- ATCATGAACGTGCCCAGCTG -3'
(R):5'- ACCTGCAGGACAGCCTTTC -3'
Posted On 2022-11-14