Mutagenetix > Incidental Mutation

Incidental Mutation 'R9745:Zc3h6'

732017

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R9745 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129017235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1062 (E1062G)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110320
AA Change: E1062G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: E1062G

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 99.1%
20x: 97.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	C	2: 111,169,663	M201V	unknown	Het
Agap2	T	A	10: 127,083,511	H488Q	unknown	Het
Ces1b	T	C	8: 93,063,997	D388G	probably benign	Het
Ces1f	T	C	8: 93,263,112	D392G	probably benign	Het
Ces5a	A	G	8: 93,502,186	V472A	probably damaging	Het
Chst1	A	G	2: 92,613,702	D173G	possibly damaging	Het
Cngb1	T	G	8: 95,241,291	E1294A	unknown	Het
Cnmd	T	C	14: 79,650,410	I124V	possibly damaging	Het
Cntnap2	A	T	6: 46,234,166	M505L	probably benign	Het
Cntnap4	T	A	8: 112,665,176	M91K	possibly damaging	Het
Cstad	A	G	2: 30,608,185	T11A	unknown	Het
Cyp2j6	A	T	4: 96,553,384	V23E	possibly damaging	Het
Dapk3	C	A	10: 81,192,760	T388K	unknown	Het
Dennd6a	G	A	14: 26,599,663	G120R	possibly damaging	Het
Disp1	A	C	1: 183,087,746	S1037A	probably damaging	Het
Egfem1	A	T	3: 29,662,383	D334V	probably damaging	Het
Egflam	C	T	15: 7,303,938	V178M	probably benign	Het
Ehbp1	T	C	11: 22,146,692	T291A	probably benign	Het
Eif5b	G	T	1: 38,045,648	V859F	probably damaging	Het
Fam161a	A	T	11: 23,023,495	Q459L	possibly damaging	Het
Fcgrt	A	C	7: 45,093,330	D342E	probably damaging	Het
Fchsd1	A	C	18: 37,969,372	D34E	probably benign	Het
Foxo4	G	A	X: 101,258,349	S209N	probably benign	Het
Galt	A	T	4: 41,758,185	M317L	possibly damaging	Het
Gfm1	A	G	3: 67,451,324	D416G	possibly damaging	Het
Glcci1	A	T	6: 8,573,278	I256L	probably benign	Het
Gm17018	A	T	19: 45,572,442	Q103L	probably benign	Het
Ibtk	C	T	9: 85,731,227	G228S	probably benign	Het
Il2rb	T	A	15: 78,488,199	D106V	probably benign	Het
Map3k6	A	T	4: 133,252,472	I1261F	probably damaging	Het
Mast2	A	G	4: 116,310,618	L1014P	probably benign	Het
Mcm2	G	A	6: 88,891,747	Q343*	probably null	Het
Megf8	A	G	7: 25,358,708	T2136A	possibly damaging	Het
Mmp28	G	A	11: 83,451,457	T103I	probably benign	Het
Mtif2	G	A	11: 29,526,587		probably benign	Het
Mtus2	A	T	5: 148,076,501	T35S	possibly damaging	Het
Ncoa2	A	T	1: 13,174,968	I502N	probably benign	Het
Nek5	A	C	8: 22,083,463	D492E	probably benign	Het
Nin	T	C	12: 70,043,125	E1172G		Het
Nsmaf	T	A	4: 6,416,662	I544F	possibly damaging	Het
Oas3	T	C	5: 120,761,219	D763G	unknown	Het
Olfr1040	C	T	2: 86,145,907	V276M	probably damaging	Het
Olfr1102	T	C	2: 87,002,143	V58A	probably benign	Het
Olfr1110	T	A	2: 87,135,439	N294I	probably damaging	Het
Olfr1191-ps1	T	A	2: 88,642,966	F66L	probably benign	Het
Olfr178	A	T	16: 58,889,902	L106Q	probably damaging	Het
Olfr434	G	A	6: 43,217,324	W137*	probably null	Het
Olfr550	A	T	7: 102,578,654	D53V	probably damaging	Het
Pcdh7	T	C	5: 57,722,280		probably null	Het
Pitx3	A	G	19: 46,136,221	S236P	possibly damaging	Het
Plscr5	T	A	9: 92,205,449	I157N	probably damaging	Het
Preb	T	C	5: 30,959,388	N54D	probably benign	Het
Pskh1	C	T	8: 105,929,772	A360V	possibly damaging	Het
Ptprk	T	C	10: 28,263,612	L111S	possibly damaging	Het
Reln	T	A	5: 21,947,527	I2314F	probably damaging	Het
Siglecg	A	G	7: 43,418,052	D681G	probably damaging	Het
Snx5	A	G	2: 144,254,796	V283A	probably benign	Het
Srpk2	C	A	5: 23,675,876		probably benign	Het
Tacr1	T	C	6: 82,492,638	Y168H	possibly damaging	Het
Tal1	G	T	4: 115,063,360	R77L	probably benign	Het
Tdrd12	T	C	7: 35,486,539		probably null	Het
Tdrd7	A	T	4: 45,994,310	N236I	possibly damaging	Het
Tdrd9	T	C	12: 112,042,696	F1012S	probably damaging	Het
Tekt2	C	T	4: 126,323,651	R207H	probably damaging	Het
Tert	T	A	13: 73,636,490	L685Q	probably damaging	Het
Th	T	G	7: 142,895,114	D342A	probably damaging	Het
Tpsg1	G	T	17: 25,372,518	V31L	probably damaging	Het
Traf3ip1	C	G	1: 91,511,373	S337*	probably null	Het
Trpv6	A	G	6: 41,623,069	F551S	probably damaging	Het
Ttc30b	T	C	2: 75,937,917	Y164C	probably benign	Het
Urah	A	G	7: 140,835,618	N23D	probably benign	Het
Vangl1	A	C	3: 102,165,353		probably null	Het
Zfp37	A	T	4: 62,192,407	V181E	possibly damaging	Het
Zfp638	T	A	6: 83,944,813	S641T	probably benign	Het
Zkscan16	A	T	4: 58,957,473	H585L	possibly damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGACTGCAAAGGATTCACACTC -3'
(R):5'- AGGGACCTGAACCTTATCAGC -3'

Sequencing Primer
(F):5'- GATGGAACCCTGCTTTGTCACAG -3'
(R):5'- AGCACTCCTGAGAATATCTGTCTG -3'

Posted On

2022-11-14