Incidental Mutation 'R9745:Nsmaf'
ID 732022
Institutional Source Beutler Lab
Gene Symbol Nsmaf
Ensembl Gene ENSMUSG00000028245
Gene Name neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms Fan, factor associated with N-SMase activation
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 6396207-6454271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 6416662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 544 (I544F)
Ref Sequence ENSEMBL: ENSMUSP00000029910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910]
AlphaFold O35242
Predicted Effect possibly damaging
Transcript: ENSMUST00000029910
AA Change: I544F

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245
AA Change: I544F

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation show no gross phenotypic abnormalities but display delayed cutaneous barrier repair. In addition, D-galactosamine-sensitized homozygotes are partially resistant to LPS- and TNF-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Nsmaf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Nsmaf APN 4 6,417,163 (GRCm39) critical splice donor site probably null
IGL00778:Nsmaf APN 4 6,435,056 (GRCm39) critical splice donor site probably null
IGL01775:Nsmaf APN 4 6,396,791 (GRCm39) missense possibly damaging 0.79
IGL02003:Nsmaf APN 4 6,418,522 (GRCm39) missense probably benign 0.02
IGL02039:Nsmaf APN 4 6,424,995 (GRCm39) splice site probably benign
IGL02085:Nsmaf APN 4 6,398,551 (GRCm39) missense probably benign 0.21
IGL02252:Nsmaf APN 4 6,398,378 (GRCm39) missense probably benign 0.00
IGL02655:Nsmaf APN 4 6,424,933 (GRCm39) missense possibly damaging 0.94
R0023:Nsmaf UTSW 4 6,408,680 (GRCm39) missense probably damaging 0.96
R0454:Nsmaf UTSW 4 6,424,874 (GRCm39) splice site probably null
R0538:Nsmaf UTSW 4 6,419,930 (GRCm39) splice site probably null
R0605:Nsmaf UTSW 4 6,418,470 (GRCm39) critical splice donor site probably null
R1033:Nsmaf UTSW 4 6,438,054 (GRCm39) missense probably damaging 1.00
R1472:Nsmaf UTSW 4 6,423,448 (GRCm39) nonsense probably null
R1519:Nsmaf UTSW 4 6,438,062 (GRCm39) missense probably benign 0.06
R1641:Nsmaf UTSW 4 6,409,884 (GRCm39) missense probably benign 0.01
R1668:Nsmaf UTSW 4 6,398,880 (GRCm39) missense probably damaging 0.98
R2212:Nsmaf UTSW 4 6,396,732 (GRCm39) missense probably damaging 0.99
R2351:Nsmaf UTSW 4 6,437,921 (GRCm39) missense probably damaging 1.00
R3862:Nsmaf UTSW 4 6,435,064 (GRCm39) missense probably benign 0.00
R4112:Nsmaf UTSW 4 6,417,188 (GRCm39) nonsense probably null
R4644:Nsmaf UTSW 4 6,419,940 (GRCm39) splice site probably benign
R4807:Nsmaf UTSW 4 6,398,542 (GRCm39) splice site probably null
R4960:Nsmaf UTSW 4 6,423,342 (GRCm39) missense probably damaging 1.00
R5556:Nsmaf UTSW 4 6,398,621 (GRCm39) missense probably benign 0.00
R5936:Nsmaf UTSW 4 6,421,017 (GRCm39) intron probably benign
R7288:Nsmaf UTSW 4 6,416,641 (GRCm39) missense probably benign
R7295:Nsmaf UTSW 4 6,438,083 (GRCm39) missense probably benign 0.00
R7378:Nsmaf UTSW 4 6,416,586 (GRCm39) missense probably benign
R7615:Nsmaf UTSW 4 6,408,563 (GRCm39) missense probably damaging 1.00
R7842:Nsmaf UTSW 4 6,435,109 (GRCm39) critical splice acceptor site probably null
R7993:Nsmaf UTSW 4 6,398,647 (GRCm39) missense probably benign 0.15
R8737:Nsmaf UTSW 4 6,396,748 (GRCm39) missense probably benign 0.15
R8856:Nsmaf UTSW 4 6,433,320 (GRCm39) nonsense probably null
R8905:Nsmaf UTSW 4 6,424,951 (GRCm39) missense probably benign 0.07
R8963:Nsmaf UTSW 4 6,428,471 (GRCm39) missense probably damaging 0.98
R9019:Nsmaf UTSW 4 6,418,523 (GRCm39) missense probably damaging 1.00
R9097:Nsmaf UTSW 4 6,416,543 (GRCm39) frame shift probably null
R9099:Nsmaf UTSW 4 6,416,543 (GRCm39) frame shift probably null
R9288:Nsmaf UTSW 4 6,414,976 (GRCm39) missense probably benign 0.01
R9328:Nsmaf UTSW 4 6,426,412 (GRCm39) missense probably damaging 1.00
R9378:Nsmaf UTSW 4 6,440,940 (GRCm39) missense probably benign 0.00
R9481:Nsmaf UTSW 4 6,414,976 (GRCm39) missense probably benign 0.01
R9556:Nsmaf UTSW 4 6,408,637 (GRCm39) missense probably benign 0.08
X0021:Nsmaf UTSW 4 6,398,543 (GRCm39) critical splice donor site probably null
X0063:Nsmaf UTSW 4 6,414,962 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATTCACTCTTTACAAGGCTCACC -3'
(R):5'- TGCTTTCAAGGTGCTAAAACAC -3'

Sequencing Primer
(F):5'- TCACCTGGGGAGTCTGTCAGAG -3'
(R):5'- GTTTGGCAACTCAAAGCTATCAGG -3'
Posted On 2022-11-14