Incidental Mutation 'R9745:Galt'
ID 732023
Institutional Source Beutler Lab
Gene Symbol Galt
Ensembl Gene ENSMUSG00000036073
Gene Name galactose-1-phosphate uridyl transferase
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.270) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 41755228-41758695 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41758185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 317 (M317L)
Ref Sequence ENSEMBL: ENSMUSP00000081745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084695] [ENSMUST00000098132] [ENSMUST00000108038] [ENSMUST00000108040] [ENSMUST00000108041] [ENSMUST00000108042]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000084695
AA Change: M317L

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081745
Gene: ENSMUSG00000036073
AA Change: M317L

DomainStartEndE-ValueType
Pfam:GalP_UDP_transf 3 177 1.8e-68 PFAM
Pfam:GalP_UDP_tr_C 183 351 2.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098132
SMART Domains Protein: ENSMUSP00000095736
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108038
AA Change: M317L

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103673
Gene: ENSMUSG00000036073
AA Change: M317L

DomainStartEndE-ValueType
Pfam:GalP_UDP_transf 3 177 3.1e-69 PFAM
Pfam:GalP_UDP_tr_C 183 351 3.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108040
SMART Domains Protein: ENSMUSP00000103675
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108042
SMART Domains Protein: ENSMUSP00000103677
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is the second enzyme in the Leloir pathway, the metabolic pathway for D-galactose catabolism. It catalyzes the conversion of galactose-1-phosphate and uridine diphosphate-glucose to glucose-1-phosphate and uridine diphosphate galactose. Deficiency of this enzyme causes the genetic metabolic disorder galactosemia. Mice lacking this protein accumulate high levels of galactose and galactose-1 phosphate but are viable and fertile. This protein is negatively regulated through signaling by the polypeptide hormone prolactin, specifically via the short isoform of the prolactin receptor and the transcription factor Forkhead box O3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal galactose metabolism, but lack symptoms of acute toxicity seen in humans with galactosemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Galt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Galt APN 4 41,758,570 (GRCm39) missense probably benign 0.02
IGL01150:Galt APN 4 41,757,786 (GRCm39) unclassified probably benign
IGL01525:Galt APN 4 41,756,068 (GRCm39) missense probably benign 0.06
IGL01720:Galt APN 4 41,757,463 (GRCm39) missense probably damaging 1.00
IGL02247:Galt APN 4 41,755,623 (GRCm39) intron probably benign
IGL02576:Galt APN 4 41,755,953 (GRCm39) intron probably benign
PIT4802001:Galt UTSW 4 41,756,764 (GRCm39) missense probably damaging 1.00
R1726:Galt UTSW 4 41,756,001 (GRCm39) nonsense probably null
R2085:Galt UTSW 4 41,758,162 (GRCm39) missense probably damaging 1.00
R2112:Galt UTSW 4 41,758,245 (GRCm39) missense probably benign
R4783:Galt UTSW 4 41,758,189 (GRCm39) missense probably damaging 0.99
R6031:Galt UTSW 4 41,757,202 (GRCm39) missense probably benign 0.01
R6031:Galt UTSW 4 41,757,202 (GRCm39) missense probably benign 0.01
R6171:Galt UTSW 4 41,757,541 (GRCm39) missense probably damaging 1.00
R6357:Galt UTSW 4 41,757,565 (GRCm39) missense probably benign 0.00
R7233:Galt UTSW 4 41,758,267 (GRCm39) missense probably benign 0.04
R7410:Galt UTSW 4 41,757,707 (GRCm39) missense possibly damaging 0.47
R8157:Galt UTSW 4 41,757,226 (GRCm39) missense probably benign 0.33
R9090:Galt UTSW 4 41,756,777 (GRCm39) missense probably benign 0.01
R9271:Galt UTSW 4 41,756,777 (GRCm39) missense probably benign 0.01
R9473:Galt UTSW 4 41,757,575 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCTAATGCCTGAGCTCCC -3'
(R):5'- TGGCGACTGAGTTCTAGGAATG -3'

Sequencing Primer
(F):5'- CTGAGCTCCCTGGTGGAAAATAC -3'
(R):5'- GAATGCAGAGATTTTTATGAGGCTC -3'
Posted On 2022-11-14