Incidental Mutation 'R9745:Zkscan16'
ID 732025
Institutional Source Beutler Lab
Gene Symbol Zkscan16
Ensembl Gene ENSMUSG00000038630
Gene Name zinc finger with KRAB and SCAN domains 16
Synonyms Zfp483
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 58943628-58958355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58957473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 585 (H585L)
Ref Sequence ENSEMBL: ENSMUSP00000103178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107554]
AlphaFold A2ALW2
Predicted Effect possibly damaging
Transcript: ENSMUST00000107554
AA Change: H585L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103178
Gene: ENSMUSG00000038630
AA Change: H585L

DomainStartEndE-ValueType
SCAN 44 153 1.9e-42 SMART
KRAB 170 230 1.66e-20 SMART
internal_repeat_1 281 452 7.49e-5 PROSPERO
ZnF_C2H2 483 505 4.79e-3 SMART
ZnF_C2H2 511 533 2.75e-3 SMART
ZnF_C2H2 539 561 1.6e-4 SMART
ZnF_C2H2 567 589 5.99e-4 SMART
ZnF_C2H2 595 617 1.99e0 SMART
ZnF_C2H2 623 645 5.14e-3 SMART
ZnF_C2H2 651 673 2.65e-5 SMART
ZnF_C2H2 679 701 1.82e-3 SMART
ZnF_C2H2 706 725 4.74e1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Other mutations in Zkscan16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Zkscan16 APN 4 58,957,709 (GRCm39) missense possibly damaging 0.86
IGL01296:Zkscan16 APN 4 58,956,690 (GRCm39) missense possibly damaging 0.53
IGL01330:Zkscan16 APN 4 58,956,483 (GRCm39) missense possibly damaging 0.85
IGL02143:Zkscan16 APN 4 58,956,911 (GRCm39) missense probably damaging 1.00
IGL02901:Zkscan16 APN 4 58,946,283 (GRCm39) missense probably damaging 0.98
IGL03399:Zkscan16 APN 4 58,956,915 (GRCm39) missense probably benign 0.33
R0271:Zkscan16 UTSW 4 58,952,391 (GRCm39) missense probably benign 0.33
R0317:Zkscan16 UTSW 4 58,957,602 (GRCm39) missense possibly damaging 0.86
R0542:Zkscan16 UTSW 4 58,956,597 (GRCm39) missense possibly damaging 0.53
R1417:Zkscan16 UTSW 4 58,952,377 (GRCm39) missense probably benign 0.33
R1674:Zkscan16 UTSW 4 58,948,918 (GRCm39) missense possibly damaging 0.96
R2014:Zkscan16 UTSW 4 58,956,525 (GRCm39) missense possibly damaging 0.96
R2246:Zkscan16 UTSW 4 58,957,329 (GRCm39) missense probably benign 0.09
R2352:Zkscan16 UTSW 4 58,951,869 (GRCm39) missense possibly damaging 0.71
R2851:Zkscan16 UTSW 4 58,957,364 (GRCm39) missense possibly damaging 0.71
R2852:Zkscan16 UTSW 4 58,957,364 (GRCm39) missense possibly damaging 0.71
R3896:Zkscan16 UTSW 4 58,946,125 (GRCm39) start gained probably benign
R4488:Zkscan16 UTSW 4 58,957,431 (GRCm39) missense possibly damaging 0.89
R4631:Zkscan16 UTSW 4 58,951,918 (GRCm39) missense probably damaging 0.98
R4825:Zkscan16 UTSW 4 58,957,809 (GRCm39) missense possibly damaging 0.73
R4912:Zkscan16 UTSW 4 58,946,506 (GRCm39) missense possibly damaging 0.85
R5014:Zkscan16 UTSW 4 58,951,892 (GRCm39) missense probably damaging 0.97
R5411:Zkscan16 UTSW 4 58,956,745 (GRCm39) frame shift probably null
R5642:Zkscan16 UTSW 4 58,957,748 (GRCm39) missense probably benign 0.11
R5809:Zkscan16 UTSW 4 58,946,481 (GRCm39) missense probably damaging 0.98
R6089:Zkscan16 UTSW 4 58,948,889 (GRCm39) missense possibly damaging 0.85
R6152:Zkscan16 UTSW 4 58,946,260 (GRCm39) missense possibly damaging 0.85
R6469:Zkscan16 UTSW 4 58,956,483 (GRCm39) missense probably damaging 0.98
R7662:Zkscan16 UTSW 4 58,957,679 (GRCm39) nonsense probably null
R7790:Zkscan16 UTSW 4 58,951,843 (GRCm39) nonsense probably null
R8150:Zkscan16 UTSW 4 58,952,407 (GRCm39) missense probably benign 0.06
R8359:Zkscan16 UTSW 4 58,957,230 (GRCm39) missense possibly damaging 0.92
R9022:Zkscan16 UTSW 4 58,957,021 (GRCm39) missense probably benign 0.03
R9133:Zkscan16 UTSW 4 58,957,722 (GRCm39) missense possibly damaging 0.93
R9641:Zkscan16 UTSW 4 58,956,577 (GRCm39) missense probably benign 0.00
X0020:Zkscan16 UTSW 4 58,956,747 (GRCm39) missense possibly damaging 0.91
Z1176:Zkscan16 UTSW 4 58,957,052 (GRCm39) missense probably damaging 1.00
Z1177:Zkscan16 UTSW 4 58,948,909 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GACGAATGTGGGAAGCGTTTC -3'
(R):5'- ACCTCAAATGCCGACTGAG -3'

Sequencing Primer
(F):5'- CCCTACGTGTGTAAACACTGTGG -3'
(R):5'- CCGACTGAGGCGGGAATG -3'
Posted On 2022-11-14