Incidental Mutation 'R9745:Tekt2'
ID 732030
Institutional Source Beutler Lab
Gene Symbol Tekt2
Ensembl Gene ENSMUSG00000028845
Gene Name tektin 2
Synonyms tektin-t
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126215914-126219481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126217444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 207 (R207H)
Ref Sequence ENSEMBL: ENSMUSP00000030658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
AlphaFold Q922G7
Predicted Effect probably damaging
Transcript: ENSMUST00000030658
AA Change: R207H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845
AA Change: R207H

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102616
AA Change: R207H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845
AA Change: R207H

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit male infertility and impaired motility of both sperm flagella and tracheal cilia due to altered dynein inner arm morphology and function. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Tekt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tekt2 APN 4 126,216,982 (GRCm39) missense possibly damaging 0.47
IGL01900:Tekt2 APN 4 126,218,421 (GRCm39) missense probably benign 0.00
IGL02452:Tekt2 APN 4 126,218,645 (GRCm39) missense possibly damaging 0.83
IGL02563:Tekt2 APN 4 126,218,418 (GRCm39) missense possibly damaging 0.82
IGL03087:Tekt2 APN 4 126,218,660 (GRCm39) missense possibly damaging 0.63
1mM(1):Tekt2 UTSW 4 126,218,403 (GRCm39) missense probably damaging 0.98
R0747:Tekt2 UTSW 4 126,217,553 (GRCm39) nonsense probably null
R1113:Tekt2 UTSW 4 126,218,711 (GRCm39) missense probably damaging 0.99
R1308:Tekt2 UTSW 4 126,218,711 (GRCm39) missense probably damaging 0.99
R1524:Tekt2 UTSW 4 126,217,442 (GRCm39) missense probably benign
R1563:Tekt2 UTSW 4 126,217,200 (GRCm39) missense probably benign 0.16
R1819:Tekt2 UTSW 4 126,217,529 (GRCm39) missense probably damaging 1.00
R1930:Tekt2 UTSW 4 126,216,610 (GRCm39) splice site probably null
R1931:Tekt2 UTSW 4 126,216,610 (GRCm39) splice site probably null
R2295:Tekt2 UTSW 4 126,217,486 (GRCm39) splice site probably null
R4888:Tekt2 UTSW 4 126,218,460 (GRCm39) missense probably benign 0.02
R4902:Tekt2 UTSW 4 126,217,263 (GRCm39) missense possibly damaging 0.95
R5202:Tekt2 UTSW 4 126,218,463 (GRCm39) missense probably benign 0.41
R5219:Tekt2 UTSW 4 126,216,057 (GRCm39) missense possibly damaging 0.51
R5839:Tekt2 UTSW 4 126,216,629 (GRCm39) missense probably damaging 1.00
R6213:Tekt2 UTSW 4 126,216,989 (GRCm39) missense probably damaging 0.99
R6498:Tekt2 UTSW 4 126,218,098 (GRCm39) missense probably benign 0.01
R6963:Tekt2 UTSW 4 126,218,110 (GRCm39) missense probably damaging 0.98
R6988:Tekt2 UTSW 4 126,217,236 (GRCm39) missense probably benign 0.02
R7148:Tekt2 UTSW 4 126,216,174 (GRCm39) missense probably benign 0.38
R8977:Tekt2 UTSW 4 126,217,266 (GRCm39) critical splice acceptor site probably null
R9340:Tekt2 UTSW 4 126,216,952 (GRCm39) missense probably benign
R9563:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9606:Tekt2 UTSW 4 126,218,693 (GRCm39) missense probably benign 0.07
R9619:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9621:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9664:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9665:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9666:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9667:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9668:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9748:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
R9749:Tekt2 UTSW 4 126,217,444 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCATCCCACTGCTGCAG -3'
(R):5'- GCTGTTCTGTCTTAGATGCAGC -3'

Sequencing Primer
(F):5'- TGGAGCTGTGGAGGCAAGC -3'
(R):5'- AGTATCCCTGCAGTCCAGTGAG -3'
Posted On 2022-11-14