Incidental Mutation 'R9745:Map3k6'
ID 732031
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Name mitogen-activated protein kinase kinase kinase 6
Synonyms Ask2, MEKK6, MAPKKK6
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 132968129-132980240 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132979783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1261 (I1261F)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030674
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000030677
AA Change: I1261F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: I1261F

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105908
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 132,970,355 (GRCm39) splice site probably benign
IGL01060:Map3k6 APN 4 132,974,613 (GRCm39) splice site probably null
IGL01116:Map3k6 APN 4 132,974,439 (GRCm39) missense probably damaging 0.98
IGL01341:Map3k6 APN 4 132,975,371 (GRCm39) missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 132,973,932 (GRCm39) splice site probably null
IGL03090:Map3k6 APN 4 132,970,677 (GRCm39) missense probably benign 0.05
IGL03096:Map3k6 APN 4 132,978,656 (GRCm39) nonsense probably null
IGL03149:Map3k6 APN 4 132,976,999 (GRCm39) missense probably damaging 1.00
R0110:Map3k6 UTSW 4 132,971,105 (GRCm39) missense probably damaging 1.00
R0142:Map3k6 UTSW 4 132,978,257 (GRCm39) missense probably benign
R0189:Map3k6 UTSW 4 132,974,252 (GRCm39) missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 132,979,970 (GRCm39) missense probably benign 0.23
R0417:Map3k6 UTSW 4 132,975,393 (GRCm39) nonsense probably null
R0595:Map3k6 UTSW 4 132,968,574 (GRCm39) missense probably damaging 0.98
R0597:Map3k6 UTSW 4 132,972,863 (GRCm39) missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 132,975,437 (GRCm39) missense probably damaging 1.00
R1099:Map3k6 UTSW 4 132,974,439 (GRCm39) missense probably damaging 1.00
R1113:Map3k6 UTSW 4 132,973,126 (GRCm39) missense probably damaging 1.00
R1308:Map3k6 UTSW 4 132,973,126 (GRCm39) missense probably damaging 1.00
R1607:Map3k6 UTSW 4 132,979,784 (GRCm39) missense probably damaging 1.00
R2217:Map3k6 UTSW 4 132,973,983 (GRCm39) missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 132,975,707 (GRCm39) missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 132,973,683 (GRCm39) missense probably benign 0.21
R3743:Map3k6 UTSW 4 132,972,384 (GRCm39) missense probably benign 0.26
R4244:Map3k6 UTSW 4 132,979,258 (GRCm39) missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 132,979,258 (GRCm39) missense possibly damaging 0.65
R4465:Map3k6 UTSW 4 132,973,644 (GRCm39) missense possibly damaging 0.66
R4482:Map3k6 UTSW 4 132,970,710 (GRCm39) missense probably benign 0.00
R4827:Map3k6 UTSW 4 132,976,160 (GRCm39) missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 132,979,054 (GRCm39) missense probably benign 0.00
R5110:Map3k6 UTSW 4 132,974,859 (GRCm39) intron probably benign
R5258:Map3k6 UTSW 4 132,974,953 (GRCm39) missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 132,974,992 (GRCm39) missense probably damaging 0.99
R5642:Map3k6 UTSW 4 132,972,855 (GRCm39) missense probably damaging 0.99
R5648:Map3k6 UTSW 4 132,970,646 (GRCm39) missense probably benign 0.25
R6102:Map3k6 UTSW 4 132,974,442 (GRCm39) critical splice donor site probably null
R6144:Map3k6 UTSW 4 132,972,986 (GRCm39) missense probably damaging 1.00
R6476:Map3k6 UTSW 4 132,977,397 (GRCm39) missense probably damaging 0.98
R6511:Map3k6 UTSW 4 132,975,389 (GRCm39) missense probably damaging 0.98
R6522:Map3k6 UTSW 4 132,977,335 (GRCm39) missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 132,978,250 (GRCm39) nonsense probably null
R6874:Map3k6 UTSW 4 132,977,967 (GRCm39) missense probably benign 0.02
R7069:Map3k6 UTSW 4 132,979,023 (GRCm39) missense probably benign 0.01
R7216:Map3k6 UTSW 4 132,974,211 (GRCm39) missense probably damaging 0.99
R7417:Map3k6 UTSW 4 132,975,707 (GRCm39) missense probably benign 0.43
R7538:Map3k6 UTSW 4 132,979,238 (GRCm39) missense probably benign
R7569:Map3k6 UTSW 4 132,977,388 (GRCm39) missense probably benign 0.04
R8003:Map3k6 UTSW 4 132,976,193 (GRCm39) missense probably benign 0.05
R8407:Map3k6 UTSW 4 132,974,904 (GRCm39) missense possibly damaging 0.95
R8817:Map3k6 UTSW 4 132,974,071 (GRCm39) missense probably benign 0.00
R8939:Map3k6 UTSW 4 132,979,954 (GRCm39) unclassified probably benign
R9285:Map3k6 UTSW 4 132,972,870 (GRCm39) missense probably damaging 1.00
R9308:Map3k6 UTSW 4 132,970,722 (GRCm39) missense probably damaging 1.00
R9400:Map3k6 UTSW 4 132,968,467 (GRCm39) missense probably damaging 1.00
R9401:Map3k6 UTSW 4 132,968,467 (GRCm39) missense probably damaging 1.00
R9573:Map3k6 UTSW 4 132,979,774 (GRCm39) missense probably damaging 0.99
R9677:Map3k6 UTSW 4 132,968,427 (GRCm39) missense probably benign 0.04
R9682:Map3k6 UTSW 4 132,975,419 (GRCm39) missense possibly damaging 0.61
R9751:Map3k6 UTSW 4 132,979,168 (GRCm39) critical splice acceptor site probably null
Z1088:Map3k6 UTSW 4 132,972,377 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCCCTTAGTATGCACCTC -3'
(R):5'- ATCAGGGATCAATGTAATTCAGCC -3'

Sequencing Primer
(F):5'- CTCTCATTATAGGGATGGGGAAACTC -3'
(R):5'- GGATCAATGTAATTCAGCCAGAAG -3'
Posted On 2022-11-14