Incidental Mutation 'R9745:Glcci1'
ID 732038
Institutional Source Beutler Lab
Gene Symbol Glcci1
Ensembl Gene ENSMUSG00000029638
Gene Name glucocorticoid induced transcript 1
Synonyms A130036A18Rik, Tssn1, GIG18, Fam117c, 2310047L21Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 8509600-8597548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8573278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 256 (I256L)
Ref Sequence ENSEMBL: ENSMUSP00000069444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064285] [ENSMUST00000161217] [ENSMUST00000161494] [ENSMUST00000162383] [ENSMUST00000162564] [ENSMUST00000162567]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064285
AA Change: I256L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069444
Gene: ENSMUSG00000029638
AA Change: I256L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 69 110 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
Pfam:FAM117 159 468 1.7e-132 PFAM
low complexity region 493 506 N/A INTRINSIC
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161217
AA Change: I68L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124167
Gene: ENSMUSG00000029638
AA Change: I68L

DomainStartEndE-ValueType
Pfam:FAM117 1 284 3.2e-104 PFAM
low complexity region 305 318 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161494
AA Change: I69L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124595
Gene: ENSMUSG00000029638
AA Change: I69L

DomainStartEndE-ValueType
Pfam:FAM117 1 237 1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162383
AA Change: I68L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125260
Gene: ENSMUSG00000029638
AA Change: I68L

DomainStartEndE-ValueType
Pfam:FAM117 1 94 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162564
Predicted Effect probably benign
Transcript: ENSMUST00000162567
AA Change: I69L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125079
Gene: ENSMUSG00000029638
AA Change: I69L

DomainStartEndE-ValueType
Pfam:FAM117 1 285 2.7e-100 PFAM
low complexity region 306 319 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Glcci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Glcci1 APN 6 8,579,596 (GRCm39) missense probably damaging 0.99
IGL02349:Glcci1 APN 6 8,558,581 (GRCm39) missense probably damaging 1.00
IGL02877:Glcci1 APN 6 8,582,757 (GRCm39) missense probably damaging 1.00
IGL03291:Glcci1 APN 6 8,579,678 (GRCm39) missense probably damaging 1.00
R1084:Glcci1 UTSW 6 8,573,221 (GRCm39) nonsense probably null
R1289:Glcci1 UTSW 6 8,593,088 (GRCm39) missense possibly damaging 0.70
R1466:Glcci1 UTSW 6 8,537,964 (GRCm39) missense probably damaging 1.00
R1466:Glcci1 UTSW 6 8,537,964 (GRCm39) missense probably damaging 1.00
R1539:Glcci1 UTSW 6 8,591,620 (GRCm39) missense probably damaging 1.00
R1584:Glcci1 UTSW 6 8,537,964 (GRCm39) missense probably damaging 1.00
R1873:Glcci1 UTSW 6 8,537,837 (GRCm39) missense probably benign 0.06
R1982:Glcci1 UTSW 6 8,592,980 (GRCm39) missense probably damaging 1.00
R2043:Glcci1 UTSW 6 8,582,590 (GRCm39) missense probably damaging 1.00
R2070:Glcci1 UTSW 6 8,558,566 (GRCm39) missense probably damaging 1.00
R4834:Glcci1 UTSW 6 8,582,601 (GRCm39) nonsense probably null
R5166:Glcci1 UTSW 6 8,537,854 (GRCm39) missense probably benign 0.23
R5390:Glcci1 UTSW 6 8,537,835 (GRCm39) missense probably benign 0.01
R6351:Glcci1 UTSW 6 8,573,203 (GRCm39) nonsense probably null
R7985:Glcci1 UTSW 6 8,573,186 (GRCm39) missense probably damaging 0.99
R8171:Glcci1 UTSW 6 8,593,167 (GRCm39) missense probably benign 0.00
R8292:Glcci1 UTSW 6 8,558,549 (GRCm39) missense probably damaging 1.00
R9186:Glcci1 UTSW 6 8,537,826 (GRCm39) missense possibly damaging 0.63
X0065:Glcci1 UTSW 6 8,591,636 (GRCm39) nonsense probably null
Z1176:Glcci1 UTSW 6 8,582,674 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CAGTTGTCTCAGTCATAACTTGAAG -3'
(R):5'- TTGGAGGGTGACACTCAGAG -3'

Sequencing Primer
(F):5'- TCTCTCCCCAAAGCAGAT -3'
(R):5'- GGCTCCCCCTTTTCAAATGAGAAG -3'
Posted On 2022-11-14