Incidental Mutation 'R9745:Or2a20'
ID 732040
Institutional Source Beutler Lab
Gene Symbol Or2a20
Ensembl Gene ENSMUSG00000059411
Gene Name olfactory receptor family 2 subfamily A member 2
Synonyms Olfr434, GA_x6K02T2P3E9-4341246-4340281, MOR261-10
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43193849-43194814 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 43194258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 137 (W137*)
Ref Sequence ENSEMBL: ENSMUSP00000149678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076752] [ENSMUST00000216562]
AlphaFold Q8VF17
Predicted Effect probably null
Transcript: ENSMUST00000076752
AA Change: W137*
SMART Domains Protein: ENSMUSP00000076039
Gene: ENSMUSG00000059411
AA Change: W137*

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.7e-62 PFAM
Pfam:7tm_1 40 289 2.1e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216562
AA Change: W137*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Or2a20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Or2a20 APN 6 43,194,782 (GRCm39) missense probably benign 0.00
R0347:Or2a20 UTSW 6 43,194,296 (GRCm39) missense probably benign
R1099:Or2a20 UTSW 6 43,194,558 (GRCm39) missense probably damaging 1.00
R1147:Or2a20 UTSW 6 43,194,146 (GRCm39) missense probably damaging 0.99
R1147:Or2a20 UTSW 6 43,194,146 (GRCm39) missense probably damaging 0.99
R1353:Or2a20 UTSW 6 43,194,624 (GRCm39) missense probably benign 0.41
R1570:Or2a20 UTSW 6 43,194,285 (GRCm39) missense probably benign
R1720:Or2a20 UTSW 6 43,194,494 (GRCm39) missense probably damaging 1.00
R2098:Or2a20 UTSW 6 43,194,437 (GRCm39) missense probably benign 0.02
R4707:Or2a20 UTSW 6 43,193,883 (GRCm39) missense probably benign 0.27
R4942:Or2a20 UTSW 6 43,193,928 (GRCm39) missense probably damaging 1.00
R5008:Or2a20 UTSW 6 43,193,991 (GRCm39) missense probably damaging 0.98
R5084:Or2a20 UTSW 6 43,194,594 (GRCm39) missense probably damaging 1.00
R6472:Or2a20 UTSW 6 43,194,293 (GRCm39) missense probably benign
R7592:Or2a20 UTSW 6 43,194,179 (GRCm39) missense probably damaging 1.00
R7756:Or2a20 UTSW 6 43,193,950 (GRCm39) nonsense probably null
R7784:Or2a20 UTSW 6 43,194,322 (GRCm39) missense possibly damaging 0.82
R8056:Or2a20 UTSW 6 43,193,978 (GRCm39) missense probably damaging 0.99
R9093:Or2a20 UTSW 6 43,194,500 (GRCm39) missense probably benign
R9193:Or2a20 UTSW 6 43,194,086 (GRCm39) missense probably benign 0.45
R9749:Or2a20 UTSW 6 43,194,258 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGGCCATTGTCGATATGG -3'
(R):5'- ATAACGACCTGATTGAGTGTTGTG -3'

Sequencing Primer
(F):5'- GCCATTGTCGATATGGCCTATGC -3'
(R):5'- CCTGATTGAGTGTTGTGTCAGCAC -3'
Posted On 2022-11-14