Mutagenetix > Incidental Mutation

Incidental Mutation 'R9745:Cntnap2'

732041

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9745 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46234166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 505 (M505L)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: M505L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: M505L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 99.1%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	C	2: 111,169,663	M201V	unknown	Het
Agap2	T	A	10: 127,083,511	H488Q	unknown	Het
Ces1b	T	C	8: 93,063,997	D388G	probably benign	Het
Ces1f	T	C	8: 93,263,112	D392G	probably benign	Het
Ces5a	A	G	8: 93,502,186	V472A	probably damaging	Het
Chst1	A	G	2: 92,613,702	D173G	possibly damaging	Het
Cngb1	T	G	8: 95,241,291	E1294A	unknown	Het
Cnmd	T	C	14: 79,650,410	I124V	possibly damaging	Het
Cntnap4	T	A	8: 112,665,176	M91K	possibly damaging	Het
Cstad	A	G	2: 30,608,185	T11A	unknown	Het
Cyp2j6	A	T	4: 96,553,384	V23E	possibly damaging	Het
Dapk3	C	A	10: 81,192,760	T388K	unknown	Het
Dennd6a	G	A	14: 26,599,663	G120R	possibly damaging	Het
Disp1	A	C	1: 183,087,746	S1037A	probably damaging	Het
Egfem1	A	T	3: 29,662,383	D334V	probably damaging	Het
Egflam	C	T	15: 7,303,938	V178M	probably benign	Het
Ehbp1	T	C	11: 22,146,692	T291A	probably benign	Het
Eif5b	G	T	1: 38,045,648	V859F	probably damaging	Het
Fam161a	A	T	11: 23,023,495	Q459L	possibly damaging	Het
Fcgrt	A	C	7: 45,093,330	D342E	probably damaging	Het
Fchsd1	A	C	18: 37,969,372	D34E	probably benign	Het
Foxo4	G	A	X: 101,258,349	S209N	probably benign	Het
Galt	A	T	4: 41,758,185	M317L	possibly damaging	Het
Gfm1	A	G	3: 67,451,324	D416G	possibly damaging	Het
Glcci1	A	T	6: 8,573,278	I256L	probably benign	Het
Gm17018	A	T	19: 45,572,442	Q103L	probably benign	Het
Ibtk	C	T	9: 85,731,227	G228S	probably benign	Het
Il2rb	T	A	15: 78,488,199	D106V	probably benign	Het
Map3k6	A	T	4: 133,252,472	I1261F	probably damaging	Het
Mast2	A	G	4: 116,310,618	L1014P	probably benign	Het
Mcm2	G	A	6: 88,891,747	Q343*	probably null	Het
Megf8	A	G	7: 25,358,708	T2136A	possibly damaging	Het
Mmp28	G	A	11: 83,451,457	T103I	probably benign	Het
Mtif2	G	A	11: 29,526,587		probably benign	Het
Mtus2	A	T	5: 148,076,501	T35S	possibly damaging	Het
Ncoa2	A	T	1: 13,174,968	I502N	probably benign	Het
Nek5	A	C	8: 22,083,463	D492E	probably benign	Het
Nin	T	C	12: 70,043,125	E1172G		Het
Nsmaf	T	A	4: 6,416,662	I544F	possibly damaging	Het
Oas3	T	C	5: 120,761,219	D763G	unknown	Het
Olfr1040	C	T	2: 86,145,907	V276M	probably damaging	Het
Olfr1102	T	C	2: 87,002,143	V58A	probably benign	Het
Olfr1110	T	A	2: 87,135,439	N294I	probably damaging	Het
Olfr1191-ps1	T	A	2: 88,642,966	F66L	probably benign	Het
Olfr178	A	T	16: 58,889,902	L106Q	probably damaging	Het
Olfr434	G	A	6: 43,217,324	W137*	probably null	Het
Olfr550	A	T	7: 102,578,654	D53V	probably damaging	Het
Pcdh7	T	C	5: 57,722,280		probably null	Het
Pitx3	A	G	19: 46,136,221	S236P	possibly damaging	Het
Plscr5	T	A	9: 92,205,449	I157N	probably damaging	Het
Preb	T	C	5: 30,959,388	N54D	probably benign	Het
Pskh1	C	T	8: 105,929,772	A360V	possibly damaging	Het
Ptprk	T	C	10: 28,263,612	L111S	possibly damaging	Het
Reln	T	A	5: 21,947,527	I2314F	probably damaging	Het
Siglecg	A	G	7: 43,418,052	D681G	probably damaging	Het
Snx5	A	G	2: 144,254,796	V283A	probably benign	Het
Srpk2	C	A	5: 23,675,876		probably benign	Het
Tacr1	T	C	6: 82,492,638	Y168H	possibly damaging	Het
Tal1	G	T	4: 115,063,360	R77L	probably benign	Het
Tdrd12	T	C	7: 35,486,539		probably null	Het
Tdrd7	A	T	4: 45,994,310	N236I	possibly damaging	Het
Tdrd9	T	C	12: 112,042,696	F1012S	probably damaging	Het
Tekt2	C	T	4: 126,323,651	R207H	probably damaging	Het
Tert	T	A	13: 73,636,490	L685Q	probably damaging	Het
Th	T	G	7: 142,895,114	D342A	probably damaging	Het
Tpsg1	G	T	17: 25,372,518	V31L	probably damaging	Het
Traf3ip1	C	G	1: 91,511,373	S337*	probably null	Het
Trpv6	A	G	6: 41,623,069	F551S	probably damaging	Het
Ttc30b	T	C	2: 75,937,917	Y164C	probably benign	Het
Urah	A	G	7: 140,835,618	N23D	probably benign	Het
Vangl1	A	C	3: 102,165,353		probably null	Het
Zc3h6	A	G	2: 129,017,235	E1062G	probably benign	Het
Zfp37	A	T	4: 62,192,407	V181E	possibly damaging	Het
Zfp638	T	A	6: 83,944,813	S641T	probably benign	Het
Zkscan16	A	T	4: 58,957,473	H585L	possibly damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GCCAATCATGTAGTATTGGACAG -3'
(R):5'- ACAGATGGCTTACCTGTCTATG -3'

Sequencing Primer
(F):5'- ATGAACCTATGGGGCCATTC -3'
(R):5'- GTCTATGATGGCACACATGTCAATGG -3'

Posted On

2022-11-14