Incidental Mutation 'R9745:Mcm2'
ID 732044
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Name minichromosome maintenance complex component 2
Synonyms BM28, CDCL1, Mcmd2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 88860456-88875762 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 88868729 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 343 (Q343*)
Ref Sequence ENSEMBL: ENSMUSP00000061923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
AlphaFold P97310
Predicted Effect probably null
Transcript: ENSMUST00000058011
AA Change: Q343*
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: Q343*

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect probably benign
Transcript: ENSMUST00000205165
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88,870,383 (GRCm39) missense probably benign 0.04
IGL01082:Mcm2 APN 6 88,864,859 (GRCm39) missense probably benign 0.05
IGL01451:Mcm2 APN 6 88,868,948 (GRCm39) splice site probably benign
IGL01534:Mcm2 APN 6 88,864,700 (GRCm39) critical splice donor site probably null
IGL01670:Mcm2 APN 6 88,864,614 (GRCm39) unclassified probably benign
IGL01724:Mcm2 APN 6 88,863,044 (GRCm39) missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88,868,708 (GRCm39) missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88,865,218 (GRCm39) nonsense probably null
dander UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
spores UTSW 6 88,874,432 (GRCm39) missense probably benign
R0254:Mcm2 UTSW 6 88,860,998 (GRCm39) missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88,869,060 (GRCm39) missense probably benign 0.12
R1740:Mcm2 UTSW 6 88,861,026 (GRCm39) missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88,866,770 (GRCm39) missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88,868,785 (GRCm39) missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88,865,234 (GRCm39) missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88,868,973 (GRCm39) missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88,874,432 (GRCm39) missense probably benign
R5701:Mcm2 UTSW 6 88,870,073 (GRCm39) missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88,861,053 (GRCm39) missense probably benign 0.05
R6118:Mcm2 UTSW 6 88,864,818 (GRCm39) missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88,866,891 (GRCm39) critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88,862,844 (GRCm39) missense probably benign 0.00
R6550:Mcm2 UTSW 6 88,863,941 (GRCm39) critical splice donor site probably null
R7184:Mcm2 UTSW 6 88,868,776 (GRCm39) missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88,864,928 (GRCm39) missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88,869,039 (GRCm39) missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88,874,293 (GRCm39) missense probably damaging 0.98
R9121:Mcm2 UTSW 6 88,861,019 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCACAAATGTGGACACAC -3'
(R):5'- AACTTCTGGTGTGCCTGTC -3'

Sequencing Primer
(F):5'- GACATGAGGCCAATCTAGTTCATGC -3'
(R):5'- GTGCCTGTCACCTCCCAAC -3'
Posted On 2022-11-14