Incidental Mutation 'R9745:Th'
ID 732051
Institutional Source Beutler Lab
Gene Symbol Th
Ensembl Gene ENSMUSG00000000214
Gene Name tyrosine hydroxylase
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 142446516-142453732 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 142448851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 342 (D342A)
Ref Sequence ENSEMBL: ENSMUSP00000000219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000219] [ENSMUST00000105929] [ENSMUST00000123057] [ENSMUST00000124951] [ENSMUST00000140344]
AlphaFold P24529
Predicted Effect probably damaging
Transcript: ENSMUST00000000219
AA Change: D342A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000219
Gene: ENSMUSG00000000214
AA Change: D342A

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 2.3e-15 PFAM
Pfam:TOH_N 29 49 2.6e-11 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 1e-49 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 495 1.2e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105929
AA Change: D247A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101549
Gene: ENSMUSG00000000214
AA Change: D247A

DomainStartEndE-ValueType
PDB:2MDA|B 8 51 1e-21 PDB
low complexity region 52 63 N/A INTRINSIC
Pfam:Biopterin_H 70 401 2.2e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123057
Predicted Effect probably benign
Transcript: ENSMUST00000124951
SMART Domains Protein: ENSMUSP00000122876
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 5e-16 PFAM
Pfam:TOH_N 28 49 4.1e-10 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 2e-52 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 232 7.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138482
Predicted Effect probably benign
Transcript: ENSMUST00000140344
SMART Domains Protein: ENSMUSP00000115434
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 11 29 5.2e-9 PFAM
low complexity region 31 43 N/A INTRINSIC
PDB:2MDA|B 45 126 7e-53 PDB
low complexity region 127 138 N/A INTRINSIC
Pfam:Biopterin_H 145 171 3.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the conversion of tyrosine to dopamine. It is the rate-limiting enzyme in the synthesis of catecholamines, hence plays a key role in the physiology of adrenergic neurons. Mutations in this gene have been associated with autosomal recessive Segawa syndrome. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are deficient in catecholamines, and usually die around embryonic day 11.5-15.5 due to cardiac failure. Treatment of the pregnant female with dihydroxyphenylalanine prevents prenatal mortality. Mice homozygous for hypomorphic targeted alleles are hypokinetic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Th
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Th APN 7 142,450,763 (GRCm39) missense probably benign 0.01
IGL02308:Th APN 7 142,451,794 (GRCm39) missense possibly damaging 0.69
IGL02417:Th APN 7 142,453,643 (GRCm39) missense probably damaging 1.00
IGL02565:Th APN 7 142,453,647 (GRCm39) missense probably damaging 1.00
IGL02896:Th APN 7 142,449,168 (GRCm39) missense probably damaging 1.00
R0311:Th UTSW 7 142,449,778 (GRCm39) missense probably damaging 1.00
R1072:Th UTSW 7 142,448,225 (GRCm39) missense probably benign
R1595:Th UTSW 7 142,450,745 (GRCm39) missense probably benign 0.06
R1756:Th UTSW 7 142,451,903 (GRCm39) nonsense probably null
R2091:Th UTSW 7 142,449,280 (GRCm39) missense probably damaging 0.98
R2850:Th UTSW 7 142,447,812 (GRCm39) nonsense probably null
R3151:Th UTSW 7 142,447,812 (GRCm39) nonsense probably null
R4458:Th UTSW 7 142,450,690 (GRCm39) missense probably benign 0.41
R4870:Th UTSW 7 142,447,834 (GRCm39) missense probably benign
R5382:Th UTSW 7 142,449,177 (GRCm39) missense probably damaging 1.00
R7874:Th UTSW 7 142,449,308 (GRCm39) nonsense probably null
R8049:Th UTSW 7 142,447,860 (GRCm39) missense probably damaging 1.00
R8425:Th UTSW 7 142,447,823 (GRCm39) missense possibly damaging 0.86
R8431:Th UTSW 7 142,446,801 (GRCm39) missense probably benign 0.00
R8970:Th UTSW 7 142,446,796 (GRCm39) missense probably damaging 1.00
R9484:Th UTSW 7 142,453,620 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCCTGGGACTTGTGTTACTAG -3'
(R):5'- GAGGACCCTGAACTTGTTGC -3'

Sequencing Primer
(F):5'- AGAAACAGTCTCTGCTTCGG -3'
(R):5'- GCCCAGTAATATCCGTGTGCAATG -3'
Posted On 2022-11-14