Incidental Mutation 'R9745:Ces5a'
ID 732055
Institutional Source Beutler Lab
Gene Symbol Ces5a
Ensembl Gene ENSMUSG00000058019
Gene Name carboxylesterase 5A
Synonyms 1700122C07Rik, Ces7, cauxin, LOC244598, 1700081L16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 94225692-94262458 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94228814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 472 (V472A)
Ref Sequence ENSEMBL: ENSMUSP00000148481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009]
AlphaFold Q6AW46
Predicted Effect probably damaging
Transcript: ENSMUST00000077816
AA Change: V472A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: V472A

DomainStartEndE-ValueType
Pfam:COesterase 10 539 3.2e-157 PFAM
Pfam:Abhydrolase_3 141 238 9.5e-7 PFAM
low complexity region 552 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212009
AA Change: V472A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Ces5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces5a APN 8 94,252,172 (GRCm39) critical splice donor site probably null
IGL01520:Ces5a APN 8 94,246,206 (GRCm39) missense probably benign 0.08
IGL01674:Ces5a APN 8 94,228,847 (GRCm39) missense probably damaging 1.00
IGL02257:Ces5a APN 8 94,252,226 (GRCm39) missense probably benign 0.00
IGL02456:Ces5a APN 8 94,255,272 (GRCm39) splice site probably benign
IGL03027:Ces5a APN 8 94,249,742 (GRCm39) splice site probably null
IGL03051:Ces5a APN 8 94,255,226 (GRCm39) missense probably damaging 1.00
IGL03264:Ces5a APN 8 94,228,898 (GRCm39) missense possibly damaging 0.74
IGL03290:Ces5a APN 8 94,246,260 (GRCm39) missense probably damaging 1.00
R0115:Ces5a UTSW 8 94,228,811 (GRCm39) missense probably damaging 0.98
R0124:Ces5a UTSW 8 94,255,183 (GRCm39) missense probably damaging 1.00
R0521:Ces5a UTSW 8 94,252,286 (GRCm39) missense probably damaging 1.00
R1404:Ces5a UTSW 8 94,228,809 (GRCm39) missense probably damaging 1.00
R1404:Ces5a UTSW 8 94,228,809 (GRCm39) missense probably damaging 1.00
R1524:Ces5a UTSW 8 94,252,293 (GRCm39) missense probably damaging 0.96
R1843:Ces5a UTSW 8 94,240,859 (GRCm39) missense probably damaging 1.00
R2029:Ces5a UTSW 8 94,261,205 (GRCm39) missense probably damaging 1.00
R2135:Ces5a UTSW 8 94,226,369 (GRCm39) missense probably benign 0.33
R2146:Ces5a UTSW 8 94,261,327 (GRCm39) missense probably benign 0.03
R2973:Ces5a UTSW 8 94,255,132 (GRCm39) missense probably damaging 1.00
R3755:Ces5a UTSW 8 94,255,130 (GRCm39) missense probably benign 0.15
R4755:Ces5a UTSW 8 94,262,305 (GRCm39) missense probably benign 0.39
R5072:Ces5a UTSW 8 94,261,296 (GRCm39) missense probably damaging 1.00
R5278:Ces5a UTSW 8 94,252,266 (GRCm39) missense probably damaging 1.00
R5419:Ces5a UTSW 8 94,226,059 (GRCm39) missense unknown
R5825:Ces5a UTSW 8 94,252,295 (GRCm39) missense probably damaging 1.00
R6318:Ces5a UTSW 8 94,261,211 (GRCm39) missense probably damaging 1.00
R6925:Ces5a UTSW 8 94,249,685 (GRCm39) splice site probably null
R6950:Ces5a UTSW 8 94,257,402 (GRCm39) missense probably benign 0.10
R7148:Ces5a UTSW 8 94,228,950 (GRCm39) missense probably damaging 1.00
R7256:Ces5a UTSW 8 94,226,154 (GRCm39) missense probably benign 0.13
R7290:Ces5a UTSW 8 94,261,311 (GRCm39) missense probably damaging 1.00
R7459:Ces5a UTSW 8 94,262,369 (GRCm39) start gained probably benign
R7674:Ces5a UTSW 8 94,240,897 (GRCm39) missense probably damaging 1.00
R7815:Ces5a UTSW 8 94,247,623 (GRCm39) missense possibly damaging 0.79
R8150:Ces5a UTSW 8 94,257,430 (GRCm39) missense probably damaging 1.00
R8771:Ces5a UTSW 8 94,255,249 (GRCm39) missense possibly damaging 0.85
R9502:Ces5a UTSW 8 94,262,308 (GRCm39) nonsense probably null
R9518:Ces5a UTSW 8 94,257,430 (GRCm39) missense probably damaging 1.00
X0024:Ces5a UTSW 8 94,240,841 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCTGAGCATATGAAATCCC -3'
(R):5'- GGTCTGTAAATTTGGCCTTGACAG -3'

Sequencing Primer
(F):5'- GCTGAGCATATGAAATCCCATCCG -3'
(R):5'- CCTTGACAGGTAGGGATGC -3'
Posted On 2022-11-14