Incidental Mutation 'R9745:Ibtk'
ID 732059
Institutional Source Beutler Lab
Gene Symbol Ibtk
Ensembl Gene ENSMUSG00000035941
Gene Name inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms 5430411K16Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 85569413-85631387 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85613280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 228 (G228S)
Ref Sequence ENSEMBL: ENSMUSP00000041145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]
AlphaFold Q6ZPR6
Predicted Effect probably benign
Transcript: ENSMUST00000039213
AA Change: G228S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941
AA Change: G228S

DomainStartEndE-ValueType
ANK 51 80 2e0 SMART
ANK 85 114 2.58e-3 SMART
Pfam:RCC1 143 192 8.1e-10 PFAM
Pfam:RCC1 195 244 1.1e-14 PFAM
Pfam:RCC1 247 299 5.3e-13 PFAM
low complexity region 307 318 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
BTB 565 745 5.48e-13 SMART
BTB 769 872 4.09e-12 SMART
low complexity region 977 990 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187521
AA Change: G228S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941
AA Change: G228S

DomainStartEndE-ValueType
ANK 51 80 1.3e-2 SMART
ANK 85 114 1.7e-5 SMART
Pfam:RCC1 143 192 1.9e-8 PFAM
Pfam:RCC1 195 244 1.4e-12 PFAM
Pfam:RCC1 247 299 2.7e-10 PFAM
low complexity region 307 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Ibtk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ibtk APN 9 85,599,598 (GRCm39) splice site probably null
IGL00852:Ibtk APN 9 85,595,654 (GRCm39) missense probably benign 0.01
IGL00907:Ibtk APN 9 85,572,384 (GRCm39) missense possibly damaging 0.51
IGL01101:Ibtk APN 9 85,614,675 (GRCm39) splice site probably benign
IGL02125:Ibtk APN 9 85,617,123 (GRCm39) missense probably damaging 1.00
IGL02214:Ibtk APN 9 85,596,232 (GRCm39) splice site probably benign
IGL02223:Ibtk APN 9 85,592,419 (GRCm39) splice site probably benign
IGL02638:Ibtk APN 9 85,601,946 (GRCm39) missense probably damaging 1.00
IGL02741:Ibtk APN 9 85,608,665 (GRCm39) missense probably damaging 1.00
IGL03299:Ibtk APN 9 85,603,189 (GRCm39) missense probably benign 0.27
IGL03493:Ibtk APN 9 85,600,972 (GRCm39) missense probably benign 0.44
Biddie UTSW 9 85,579,290 (GRCm39) missense possibly damaging 0.87
R0026:Ibtk UTSW 9 85,572,356 (GRCm39) missense probably benign
R0026:Ibtk UTSW 9 85,572,356 (GRCm39) missense probably benign
R0558:Ibtk UTSW 9 85,619,591 (GRCm39) missense probably damaging 0.99
R0569:Ibtk UTSW 9 85,590,234 (GRCm39) splice site probably benign
R0932:Ibtk UTSW 9 85,617,099 (GRCm39) missense probably damaging 1.00
R0973:Ibtk UTSW 9 85,625,630 (GRCm39) missense probably damaging 1.00
R1237:Ibtk UTSW 9 85,602,801 (GRCm39) missense probably benign 0.00
R1245:Ibtk UTSW 9 85,602,795 (GRCm39) critical splice donor site probably null
R1462:Ibtk UTSW 9 85,606,198 (GRCm39) missense probably damaging 0.99
R1462:Ibtk UTSW 9 85,606,198 (GRCm39) missense probably damaging 0.99
R1921:Ibtk UTSW 9 85,585,135 (GRCm39) missense probably benign
R2090:Ibtk UTSW 9 85,603,046 (GRCm39) missense probably benign 0.01
R2109:Ibtk UTSW 9 85,588,603 (GRCm39) missense probably benign
R2277:Ibtk UTSW 9 85,585,204 (GRCm39) missense probably benign
R2437:Ibtk UTSW 9 85,590,178 (GRCm39) missense probably benign 0.27
R2446:Ibtk UTSW 9 85,585,126 (GRCm39) missense probably benign 0.22
R3107:Ibtk UTSW 9 85,592,467 (GRCm39) missense probably damaging 1.00
R3876:Ibtk UTSW 9 85,600,479 (GRCm39) missense probably benign 0.06
R4160:Ibtk UTSW 9 85,585,143 (GRCm39) missense probably benign 0.01
R4273:Ibtk UTSW 9 85,608,784 (GRCm39) missense probably damaging 1.00
R4321:Ibtk UTSW 9 85,617,125 (GRCm39) missense possibly damaging 0.49
R4827:Ibtk UTSW 9 85,610,607 (GRCm39) missense probably benign 0.04
R4947:Ibtk UTSW 9 85,592,465 (GRCm39) missense probably benign 0.00
R5228:Ibtk UTSW 9 85,608,742 (GRCm39) missense possibly damaging 0.58
R5268:Ibtk UTSW 9 85,625,743 (GRCm39) missense probably benign 0.00
R5327:Ibtk UTSW 9 85,619,519 (GRCm39) critical splice donor site probably null
R5344:Ibtk UTSW 9 85,617,057 (GRCm39) missense possibly damaging 0.90
R5414:Ibtk UTSW 9 85,608,742 (GRCm39) missense possibly damaging 0.58
R5502:Ibtk UTSW 9 85,602,916 (GRCm39) missense probably benign 0.13
R5756:Ibtk UTSW 9 85,613,307 (GRCm39) missense possibly damaging 0.51
R7144:Ibtk UTSW 9 85,625,744 (GRCm39) missense probably benign 0.03
R7196:Ibtk UTSW 9 85,625,709 (GRCm39) missense probably damaging 1.00
R7490:Ibtk UTSW 9 85,600,987 (GRCm39) critical splice acceptor site probably null
R7571:Ibtk UTSW 9 85,604,353 (GRCm39) missense probably benign
R7757:Ibtk UTSW 9 85,579,290 (GRCm39) missense possibly damaging 0.87
R8007:Ibtk UTSW 9 85,572,770 (GRCm39) missense probably benign 0.09
R8065:Ibtk UTSW 9 85,602,916 (GRCm39) missense probably benign 0.13
R8407:Ibtk UTSW 9 85,603,119 (GRCm39) missense possibly damaging 0.93
R8711:Ibtk UTSW 9 85,606,208 (GRCm39) missense probably benign
R8753:Ibtk UTSW 9 85,610,819 (GRCm39) missense probably benign 0.01
R8835:Ibtk UTSW 9 85,619,563 (GRCm39) missense possibly damaging 0.50
R8906:Ibtk UTSW 9 85,625,457 (GRCm39) missense possibly damaging 0.91
R8980:Ibtk UTSW 9 85,614,783 (GRCm39) nonsense probably null
R9140:Ibtk UTSW 9 85,617,114 (GRCm39) missense probably damaging 1.00
R9230:Ibtk UTSW 9 85,585,702 (GRCm39) critical splice donor site probably null
R9406:Ibtk UTSW 9 85,603,393 (GRCm39) nonsense probably null
X0021:Ibtk UTSW 9 85,579,227 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTCCATGTTTTATAGGAAATCAACACC -3'
(R):5'- AATTTGCATTTGGGATACACTTGAGAC -3'

Sequencing Primer
(F):5'- AAAGCTTACCTGTCTGGG -3'
(R):5'- CAGGTATTGCTAGGCCTGACATTATC -3'
Posted On 2022-11-14