Incidental Mutation 'R9745:Agap2'
ID 732063
Institutional Source Beutler Lab
Gene Symbol Agap2
Ensembl Gene ENSMUSG00000025422
Gene Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms Centg1
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.346) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 126911154-126929039 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126919380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 488 (H488Q)
Ref Sequence ENSEMBL: ENSMUSP00000043466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039259] [ENSMUST00000217941]
AlphaFold Q3UHD9
Predicted Effect unknown
Transcript: ENSMUST00000039259
AA Change: H488Q
SMART Domains Protein: ENSMUSP00000043466
Gene: ENSMUSG00000025422
AA Change: H488Q

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
low complexity region 222 257 N/A INTRINSIC
low complexity region 306 322 N/A INTRINSIC
low complexity region 349 376 N/A INTRINSIC
Pfam:Ras 402 562 3.6e-16 PFAM
low complexity region 575 590 N/A INTRINSIC
low complexity region 600 609 N/A INTRINSIC
PH 671 906 4.35e-14 SMART
ArfGap 925 1045 8.8e-62 SMART
low complexity region 1052 1071 N/A INTRINSIC
ANK 1084 1113 1.15e0 SMART
ANK 1117 1145 3.69e2 SMART
low complexity region 1148 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217941
AA Change: H488Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the centaurin GTPase family. This gene product regulates the activity of multiple kinases, including PI3K. Reduced expression of this gene results in multiple defects, including neural deficiencies, while increased expression of this gene has been observed in some tumors. Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lactation due to abnormal mammary gland growth during lactation, failure of insulin-suppressed gluconeogenesis, and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Agap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Agap2 APN 10 126,923,865 (GRCm39) missense unknown
IGL01690:Agap2 APN 10 126,918,827 (GRCm39) splice site probably benign
IGL01765:Agap2 APN 10 126,919,104 (GRCm39) missense unknown
IGL02029:Agap2 APN 10 126,916,152 (GRCm39) missense unknown
IGL02525:Agap2 APN 10 126,919,070 (GRCm39) splice site probably null
IGL03019:Agap2 APN 10 126,927,431 (GRCm39) splice site probably benign
R0086:Agap2 UTSW 10 126,923,751 (GRCm39) splice site probably null
R0197:Agap2 UTSW 10 126,927,571 (GRCm39) missense possibly damaging 0.66
R0345:Agap2 UTSW 10 126,923,764 (GRCm39) missense unknown
R0363:Agap2 UTSW 10 126,926,834 (GRCm39) missense probably damaging 1.00
R0682:Agap2 UTSW 10 126,919,351 (GRCm39) missense unknown
R0787:Agap2 UTSW 10 126,921,019 (GRCm39) missense unknown
R0882:Agap2 UTSW 10 126,923,319 (GRCm39) missense unknown
R0883:Agap2 UTSW 10 126,927,571 (GRCm39) missense possibly damaging 0.66
R1445:Agap2 UTSW 10 126,926,981 (GRCm39) splice site probably benign
R1800:Agap2 UTSW 10 126,927,540 (GRCm39) missense probably damaging 1.00
R1854:Agap2 UTSW 10 126,916,385 (GRCm39) missense unknown
R1925:Agap2 UTSW 10 126,926,744 (GRCm39) missense probably damaging 1.00
R1986:Agap2 UTSW 10 126,918,913 (GRCm39) nonsense probably null
R2050:Agap2 UTSW 10 126,916,130 (GRCm39) nonsense probably null
R2267:Agap2 UTSW 10 126,918,297 (GRCm39) splice site probably benign
R2269:Agap2 UTSW 10 126,918,297 (GRCm39) splice site probably benign
R4174:Agap2 UTSW 10 126,926,383 (GRCm39) missense probably damaging 0.98
R4397:Agap2 UTSW 10 126,926,352 (GRCm39) missense unknown
R4418:Agap2 UTSW 10 126,927,519 (GRCm39) missense probably damaging 1.00
R4472:Agap2 UTSW 10 126,927,082 (GRCm39) missense probably damaging 1.00
R4612:Agap2 UTSW 10 126,915,965 (GRCm39) missense unknown
R4690:Agap2 UTSW 10 126,927,244 (GRCm39) missense possibly damaging 0.91
R4744:Agap2 UTSW 10 126,926,072 (GRCm39) critical splice donor site probably null
R5316:Agap2 UTSW 10 126,918,296 (GRCm39) splice site probably null
R5533:Agap2 UTSW 10 126,918,911 (GRCm39) missense probably damaging 1.00
R5680:Agap2 UTSW 10 126,923,880 (GRCm39) missense unknown
R6010:Agap2 UTSW 10 126,926,779 (GRCm39) missense probably damaging 1.00
R6276:Agap2 UTSW 10 126,925,229 (GRCm39) critical splice donor site probably null
R6356:Agap2 UTSW 10 126,918,865 (GRCm39) missense unknown
R7138:Agap2 UTSW 10 126,923,154 (GRCm39) missense unknown
R7154:Agap2 UTSW 10 126,927,524 (GRCm39) missense probably benign 0.34
R7497:Agap2 UTSW 10 126,926,834 (GRCm39) missense probably damaging 0.99
R7718:Agap2 UTSW 10 126,915,734 (GRCm39) missense possibly damaging 0.68
R7720:Agap2 UTSW 10 126,926,957 (GRCm39) missense probably damaging 0.96
R7893:Agap2 UTSW 10 126,916,064 (GRCm39) missense unknown
R7933:Agap2 UTSW 10 126,922,789 (GRCm39) splice site probably benign
R8337:Agap2 UTSW 10 126,924,194 (GRCm39) missense unknown
R8372:Agap2 UTSW 10 126,925,185 (GRCm39) missense unknown
R8428:Agap2 UTSW 10 126,923,175 (GRCm39) missense unknown
R8861:Agap2 UTSW 10 126,926,383 (GRCm39) missense unknown
R9082:Agap2 UTSW 10 126,918,911 (GRCm39) missense probably damaging 1.00
R9341:Agap2 UTSW 10 126,927,559 (GRCm39) missense unknown
R9354:Agap2 UTSW 10 126,923,104 (GRCm39) missense unknown
R9650:Agap2 UTSW 10 126,927,653 (GRCm39) missense unknown
Z1088:Agap2 UTSW 10 126,924,111 (GRCm39) missense unknown
Z1176:Agap2 UTSW 10 126,916,094 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCGGTATTCAGAAGCACTCATTC -3'
(R):5'- TCCTTATTTGGGCATCAGGC -3'

Sequencing Primer
(F):5'- GTATTCAGAAGCACTCATTCCCTGG -3'
(R):5'- CCTCTAGAGGGATGCTGGAATC -3'
Posted On 2022-11-14