Incidental Mutation 'R9745:Ehbp1'
ID 732064
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene Name EH domain binding protein 1
Synonyms Flj21950, KIAA0903-like
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.829) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 21955825-22237086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22096692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 291 (T291A)
Ref Sequence ENSEMBL: ENSMUSP00000105191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000134293] [ENSMUST00000180360]
AlphaFold Q69ZW3
Predicted Effect probably benign
Transcript: ENSMUST00000045167
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109563
AA Change: T291A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: T291A

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134293
AA Change: T256A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118583
Gene: ENSMUSG00000042302
AA Change: T256A

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.5e-33 PFAM
low complexity region 185 205 N/A INTRINSIC
Blast:DUF3585 206 250 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180360
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22,197,967 (GRCm39) splice site probably benign
IGL00786:Ehbp1 APN 11 22,050,460 (GRCm39) missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22,088,022 (GRCm39) missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22,039,636 (GRCm39) missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22,045,611 (GRCm39) missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22,122,883 (GRCm39) missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22,039,584 (GRCm39) missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22,051,115 (GRCm39) missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22,051,218 (GRCm39) missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22,235,486 (GRCm39) critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22,046,048 (GRCm39) missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22,039,653 (GRCm39) missense probably damaging 1.00
trajan UTSW 11 22,101,850 (GRCm39) missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22,039,683 (GRCm39) splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22,003,494 (GRCm39) missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22,181,992 (GRCm39) splice site probably benign
R0294:Ehbp1 UTSW 11 22,045,427 (GRCm39) missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22,045,886 (GRCm39) missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22,101,836 (GRCm39) missense probably benign
R0468:Ehbp1 UTSW 11 22,119,184 (GRCm39) splice site probably benign
R0943:Ehbp1 UTSW 11 22,045,883 (GRCm39) missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22,012,831 (GRCm39) missense probably benign 0.25
R1481:Ehbp1 UTSW 11 21,956,782 (GRCm39) makesense probably null
R1493:Ehbp1 UTSW 11 21,956,866 (GRCm39) missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22,009,231 (GRCm39) missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22,046,000 (GRCm39) missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22,096,694 (GRCm39) missense probably benign
R1696:Ehbp1 UTSW 11 22,003,441 (GRCm39) missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22,101,850 (GRCm39) missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22,009,228 (GRCm39) missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22,045,462 (GRCm39) missense probably benign
R2436:Ehbp1 UTSW 11 22,039,524 (GRCm39) critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22,050,465 (GRCm39) missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22,087,867 (GRCm39) missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22,087,867 (GRCm39) missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22,235,498 (GRCm39) missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22,045,898 (GRCm39) missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22,045,898 (GRCm39) missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22,101,843 (GRCm39) missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22,045,892 (GRCm39) missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22,051,164 (GRCm39) missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22,051,164 (GRCm39) missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22,189,169 (GRCm39) missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22,051,073 (GRCm39) missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22,045,370 (GRCm39) missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22,087,846 (GRCm39) missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22,101,887 (GRCm39) missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22,189,156 (GRCm39) missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22,235,684 (GRCm39) start gained probably benign
R6685:Ehbp1 UTSW 11 22,096,641 (GRCm39) missense probably benign 0.01
R6893:Ehbp1 UTSW 11 21,964,945 (GRCm39) missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22,003,529 (GRCm39) nonsense probably null
R7465:Ehbp1 UTSW 11 22,088,001 (GRCm39) missense probably benign
R7722:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R7724:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R7797:Ehbp1 UTSW 11 22,046,109 (GRCm39) missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22,096,542 (GRCm39) nonsense probably null
R8088:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R8218:Ehbp1 UTSW 11 22,046,096 (GRCm39) missense possibly damaging 0.77
R8235:Ehbp1 UTSW 11 22,189,153 (GRCm39) missense probably damaging 1.00
R8267:Ehbp1 UTSW 11 22,096,562 (GRCm39) missense probably benign 0.02
R8318:Ehbp1 UTSW 11 22,087,980 (GRCm39) missense probably benign 0.05
R8334:Ehbp1 UTSW 11 21,957,170 (GRCm39) missense probably damaging 1.00
R8425:Ehbp1 UTSW 11 21,963,495 (GRCm39) missense probably damaging 1.00
R8439:Ehbp1 UTSW 11 22,046,109 (GRCm39) missense possibly damaging 0.79
R8493:Ehbp1 UTSW 11 22,235,842 (GRCm39) start gained probably benign
R8745:Ehbp1 UTSW 11 22,119,064 (GRCm39) missense possibly damaging 0.78
R8824:Ehbp1 UTSW 11 22,182,053 (GRCm39) missense probably damaging 0.98
R8964:Ehbp1 UTSW 11 22,101,154 (GRCm39) nonsense probably null
R8987:Ehbp1 UTSW 11 22,003,531 (GRCm39) missense probably damaging 1.00
R9144:Ehbp1 UTSW 11 22,018,463 (GRCm39) missense probably damaging 1.00
R9187:Ehbp1 UTSW 11 22,101,184 (GRCm39) missense probably damaging 0.99
R9448:Ehbp1 UTSW 11 22,087,881 (GRCm39) missense probably benign
R9549:Ehbp1 UTSW 11 22,012,788 (GRCm39) missense probably benign 0.44
R9612:Ehbp1 UTSW 11 22,119,124 (GRCm39) missense probably damaging 0.99
R9645:Ehbp1 UTSW 11 22,051,052 (GRCm39) missense probably damaging 1.00
R9678:Ehbp1 UTSW 11 22,101,108 (GRCm39) missense possibly damaging 0.89
RF016:Ehbp1 UTSW 11 22,096,646 (GRCm39) missense probably benign
RF037:Ehbp1 UTSW 11 21,956,783 (GRCm39) small deletion probably benign
X0018:Ehbp1 UTSW 11 22,051,085 (GRCm39) missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22,045,590 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTCATGTCTACAGGTCTTAGG -3'
(R):5'- GAGTTCTCTAACGAAGGAGGC -3'

Sequencing Primer
(F):5'- ACTGTGGAGTCTGTACAC -3'
(R):5'- TTCTCTAACGAAGGAGGCAAAAATC -3'
Posted On 2022-11-14