Incidental Mutation 'R9745:Tdrd9'
ID 732069
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Name tudor domain containing 9
Synonyms 4930441E05Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 111937993-112035288 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112009130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1012 (F1012S)
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
AlphaFold Q14BI7
Predicted Effect probably damaging
Transcript: ENSMUST00000079009
AA Change: F1012S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: F1012S

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112,006,868 (GRCm39) missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112,006,868 (GRCm39) missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112,013,423 (GRCm39) missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111,958,922 (GRCm39) missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112,010,733 (GRCm39) missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112,009,274 (GRCm39) missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 111,992,015 (GRCm39) nonsense probably null
R0453:Tdrd9 UTSW 12 112,034,673 (GRCm39) missense probably benign
R0655:Tdrd9 UTSW 12 112,006,899 (GRCm39) missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 111,974,014 (GRCm39) intron probably benign
R1073:Tdrd9 UTSW 12 111,989,693 (GRCm39) missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112,005,842 (GRCm39) missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112,011,238 (GRCm39) missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112,002,844 (GRCm39) missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 111,989,687 (GRCm39) nonsense probably null
R1651:Tdrd9 UTSW 12 111,991,140 (GRCm39) missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112,002,873 (GRCm39) missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112,011,246 (GRCm39) missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112,030,061 (GRCm39) splice site probably benign
R2386:Tdrd9 UTSW 12 111,982,334 (GRCm39) missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 111,997,695 (GRCm39) missense probably benign
R2915:Tdrd9 UTSW 12 112,006,895 (GRCm39) missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112,008,106 (GRCm39) missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111,958,973 (GRCm39) missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 111,979,920 (GRCm39) nonsense probably null
R4237:Tdrd9 UTSW 12 112,034,059 (GRCm39) nonsense probably null
R4482:Tdrd9 UTSW 12 111,980,935 (GRCm39) critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112,009,243 (GRCm39) missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111,960,259 (GRCm39) missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112,008,123 (GRCm39) missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111,963,269 (GRCm39) nonsense probably null
R5218:Tdrd9 UTSW 12 112,029,909 (GRCm39) intron probably benign
R5275:Tdrd9 UTSW 12 112,018,346 (GRCm39) nonsense probably null
R5295:Tdrd9 UTSW 12 112,018,346 (GRCm39) nonsense probably null
R5301:Tdrd9 UTSW 12 112,002,963 (GRCm39) critical splice donor site probably null
R5339:Tdrd9 UTSW 12 111,993,556 (GRCm39) missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 111,989,702 (GRCm39) missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111,964,336 (GRCm39) splice site probably null
R5590:Tdrd9 UTSW 12 112,018,414 (GRCm39) missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112,009,153 (GRCm39) missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111,951,475 (GRCm39) missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 111,979,720 (GRCm39) missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112,034,632 (GRCm39) missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 111,992,334 (GRCm39) splice site probably null
R6335:Tdrd9 UTSW 12 112,008,186 (GRCm39) critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112,001,042 (GRCm39) missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 111,993,547 (GRCm39) missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112,002,788 (GRCm39) splice site probably benign
R6987:Tdrd9 UTSW 12 111,992,027 (GRCm39) missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111,958,904 (GRCm39) missense probably benign
R7158:Tdrd9 UTSW 12 112,002,800 (GRCm39) missense probably benign 0.08
R7220:Tdrd9 UTSW 12 111,980,888 (GRCm39) missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111,951,476 (GRCm39) missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112,034,071 (GRCm39) missense probably benign 0.00
R7751:Tdrd9 UTSW 12 111,958,982 (GRCm39) missense probably benign 0.09
R7809:Tdrd9 UTSW 12 111,999,155 (GRCm39) missense probably damaging 0.99
R7844:Tdrd9 UTSW 12 111,964,386 (GRCm39) missense possibly damaging 0.63
R7854:Tdrd9 UTSW 12 112,013,395 (GRCm39) missense probably benign 0.00
R7903:Tdrd9 UTSW 12 112,018,410 (GRCm39) missense possibly damaging 0.95
R7938:Tdrd9 UTSW 12 111,997,649 (GRCm39) missense possibly damaging 0.86
R8018:Tdrd9 UTSW 12 112,010,822 (GRCm39) missense probably damaging 0.99
R8018:Tdrd9 UTSW 12 111,999,180 (GRCm39) missense probably benign 0.12
R8090:Tdrd9 UTSW 12 111,982,369 (GRCm39) missense probably damaging 1.00
R8157:Tdrd9 UTSW 12 111,951,500 (GRCm39) missense probably benign 0.44
R8198:Tdrd9 UTSW 12 112,006,863 (GRCm39) missense probably damaging 1.00
R8203:Tdrd9 UTSW 12 111,992,064 (GRCm39) missense probably damaging 1.00
R8512:Tdrd9 UTSW 12 112,012,627 (GRCm39) missense probably benign
R8721:Tdrd9 UTSW 12 112,002,889 (GRCm39) missense probably damaging 1.00
R8889:Tdrd9 UTSW 12 111,979,718 (GRCm39) missense probably benign 0.07
R8892:Tdrd9 UTSW 12 111,979,718 (GRCm39) missense probably benign 0.07
R9276:Tdrd9 UTSW 12 111,980,935 (GRCm39) critical splice donor site probably null
R9459:Tdrd9 UTSW 12 111,992,007 (GRCm39) missense probably damaging 1.00
R9484:Tdrd9 UTSW 12 112,012,684 (GRCm39) missense probably damaging 0.97
R9657:Tdrd9 UTSW 12 112,002,824 (GRCm39) missense possibly damaging 0.50
X0018:Tdrd9 UTSW 12 112,005,763 (GRCm39) missense probably benign 0.24
Z1177:Tdrd9 UTSW 12 111,982,355 (GRCm39) missense probably damaging 1.00
Z1177:Tdrd9 UTSW 12 111,960,325 (GRCm39) missense probably damaging 0.96
Z1177:Tdrd9 UTSW 12 111,938,088 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGCATACTCCTTCCCAAAGAG -3'
(R):5'- TGACGTTGACAGCATCCTGG -3'

Sequencing Primer
(F):5'- TGCATAGTGAGTTCCAAGCC -3'
(R):5'- TGGAGAACACCTTCACCA -3'
Posted On 2022-11-14