Incidental Mutation 'R9745:Cnmd'
ID 732072
Institutional Source Beutler Lab
Gene Symbol Cnmd
Ensembl Gene ENSMUSG00000022025
Gene Name chondromodulin
Synonyms Bricd3, Chondromodulin 1, Chmd, ChM-I, Lect1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 79875130-79899610 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79887850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 124 (I124V)
Ref Sequence ENSEMBL: ENSMUSP00000126958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022603] [ENSMUST00000165835]
AlphaFold Q9Z1F6
Predicted Effect probably benign
Transcript: ENSMUST00000022603
AA Change: I124V

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022603
Gene: ENSMUSG00000022025
AA Change: I124V

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165835
AA Change: I124V

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126958
Gene: ENSMUSG00000022025
AA Change: I124V

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphologic defects. While cartilage development and embryonic endochondral bone formation were found to be normal in mutant mice, one line of targeted mutants showed increased bone density and impairedbone resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Cnmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cnmd APN 14 79,879,508 (GRCm39) splice site probably benign
IGL02556:Cnmd APN 14 79,899,400 (GRCm39) missense probably benign 0.00
IGL03034:Cnmd APN 14 79,879,368 (GRCm39) missense probably benign
R0529:Cnmd UTSW 14 79,879,481 (GRCm39) missense probably benign 0.00
R0811:Cnmd UTSW 14 79,898,863 (GRCm39) missense probably damaging 1.00
R0812:Cnmd UTSW 14 79,898,863 (GRCm39) missense probably damaging 1.00
R0844:Cnmd UTSW 14 79,879,391 (GRCm39) missense probably benign 0.37
R2401:Cnmd UTSW 14 79,894,045 (GRCm39) missense probably damaging 0.98
R2419:Cnmd UTSW 14 79,875,488 (GRCm39) missense probably damaging 1.00
R3697:Cnmd UTSW 14 79,875,421 (GRCm39) missense probably damaging 1.00
R4640:Cnmd UTSW 14 79,894,093 (GRCm39) missense probably damaging 1.00
R4841:Cnmd UTSW 14 79,887,762 (GRCm39) missense possibly damaging 0.94
R4845:Cnmd UTSW 14 79,899,448 (GRCm39) missense probably benign
R5157:Cnmd UTSW 14 79,894,126 (GRCm39) missense probably benign 0.39
R5959:Cnmd UTSW 14 79,894,109 (GRCm39) missense probably damaging 1.00
R6033:Cnmd UTSW 14 79,898,945 (GRCm39) missense probably benign 0.00
R6033:Cnmd UTSW 14 79,898,945 (GRCm39) missense probably benign 0.00
R7421:Cnmd UTSW 14 79,882,947 (GRCm39) missense probably benign 0.25
R7640:Cnmd UTSW 14 79,898,974 (GRCm39) missense possibly damaging 0.86
R8007:Cnmd UTSW 14 79,875,406 (GRCm39) missense probably damaging 1.00
R8350:Cnmd UTSW 14 79,882,821 (GRCm39) nonsense probably null
R8450:Cnmd UTSW 14 79,882,821 (GRCm39) nonsense probably null
R9009:Cnmd UTSW 14 79,894,085 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGGTTGTAGTCATGAACCTACG -3'
(R):5'- ATCATCACTCCTCCTGGGTG -3'

Sequencing Primer
(F):5'- CGAAGGAAAAAGATCTTCAGCGTTC -3'
(R):5'- ACTCCTCCTGGGTGTGGTC -3'
Posted On 2022-11-14