Incidental Mutation 'R9745:Egflam'
ID 732073
Institutional Source Beutler Lab
Gene Symbol Egflam
Ensembl Gene ENSMUSG00000042961
Gene Name EGF-like, fibronectin type III and laminin G domains
Synonyms pikachurin, nectican
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 7235601-7427876 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7333419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 178 (V178M)
Ref Sequence ENSEMBL: ENSMUSP00000094238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058593] [ENSMUST00000096494] [ENSMUST00000160207]
AlphaFold Q4VBE4
Predicted Effect probably benign
Transcript: ENSMUST00000058593
AA Change: V178M

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055599
Gene: ENSMUSG00000042961
AA Change: V178M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 852 988 1.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096494
AA Change: V178M

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000094238
Gene: ENSMUSG00000042961
AA Change: V178M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 860 996 1.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160207
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile under normal conditions. They exhibit abnormal photoreceptor ribbon synapses, resulting in alteration in synaptic signal transmission and visual function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Fchsd1 A C 18: 38,102,425 (GRCm39) D34E probably benign Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Egflam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Egflam APN 15 7,249,245 (GRCm39) missense probably damaging 1.00
IGL02352:Egflam APN 15 7,263,706 (GRCm39) missense probably benign 0.01
IGL02359:Egflam APN 15 7,263,706 (GRCm39) missense probably benign 0.01
IGL02389:Egflam APN 15 7,279,559 (GRCm39) missense probably benign 0.01
IGL02400:Egflam APN 15 7,276,534 (GRCm39) missense probably benign 0.00
IGL02530:Egflam APN 15 7,252,293 (GRCm39) missense probably damaging 1.00
IGL02892:Egflam APN 15 7,319,277 (GRCm39) missense probably benign
R0047:Egflam UTSW 15 7,282,911 (GRCm39) missense possibly damaging 0.56
R0047:Egflam UTSW 15 7,282,911 (GRCm39) missense possibly damaging 0.56
R0345:Egflam UTSW 15 7,319,475 (GRCm39) splice site probably null
R0504:Egflam UTSW 15 7,252,239 (GRCm39) missense probably damaging 1.00
R0532:Egflam UTSW 15 7,263,718 (GRCm39) missense probably benign 0.19
R0573:Egflam UTSW 15 7,271,906 (GRCm39) nonsense probably null
R0609:Egflam UTSW 15 7,283,004 (GRCm39) missense possibly damaging 0.65
R0648:Egflam UTSW 15 7,237,190 (GRCm39) missense probably damaging 1.00
R0653:Egflam UTSW 15 7,279,509 (GRCm39) critical splice donor site probably null
R1099:Egflam UTSW 15 7,281,903 (GRCm39) missense probably benign 0.00
R1711:Egflam UTSW 15 7,319,396 (GRCm39) missense possibly damaging 0.85
R1842:Egflam UTSW 15 7,333,422 (GRCm39) missense probably benign 0.00
R1964:Egflam UTSW 15 7,276,586 (GRCm39) missense probably damaging 0.97
R2001:Egflam UTSW 15 7,272,048 (GRCm39) missense probably benign 0.18
R2008:Egflam UTSW 15 7,267,285 (GRCm39) missense possibly damaging 0.95
R2134:Egflam UTSW 15 7,263,760 (GRCm39) missense probably damaging 0.97
R2852:Egflam UTSW 15 7,249,182 (GRCm39) missense probably damaging 1.00
R2853:Egflam UTSW 15 7,249,182 (GRCm39) missense probably damaging 1.00
R4257:Egflam UTSW 15 7,283,907 (GRCm39) splice site probably null
R4346:Egflam UTSW 15 7,263,759 (GRCm39) nonsense probably null
R4380:Egflam UTSW 15 7,273,350 (GRCm39) missense possibly damaging 0.70
R4538:Egflam UTSW 15 7,281,918 (GRCm39) missense probably damaging 1.00
R4746:Egflam UTSW 15 7,254,120 (GRCm39) splice site probably null
R4909:Egflam UTSW 15 7,249,110 (GRCm39) missense probably damaging 1.00
R5027:Egflam UTSW 15 7,283,125 (GRCm39) missense probably benign 0.00
R5314:Egflam UTSW 15 7,333,493 (GRCm39) missense probably damaging 1.00
R5439:Egflam UTSW 15 7,254,144 (GRCm39) missense probably damaging 0.99
R5495:Egflam UTSW 15 7,280,722 (GRCm39) missense probably damaging 1.00
R5626:Egflam UTSW 15 7,280,688 (GRCm39) missense possibly damaging 0.89
R5931:Egflam UTSW 15 7,273,338 (GRCm39) missense possibly damaging 0.49
R5977:Egflam UTSW 15 7,347,726 (GRCm39) missense possibly damaging 0.94
R6258:Egflam UTSW 15 7,263,773 (GRCm39) missense probably damaging 0.98
R6395:Egflam UTSW 15 7,261,176 (GRCm39) missense probably damaging 1.00
R6497:Egflam UTSW 15 7,280,784 (GRCm39) splice site probably null
R6736:Egflam UTSW 15 7,249,206 (GRCm39) missense probably damaging 1.00
R7586:Egflam UTSW 15 7,238,082 (GRCm39) missense probably damaging 1.00
R7764:Egflam UTSW 15 7,347,736 (GRCm39) missense probably damaging 0.98
R7781:Egflam UTSW 15 7,283,227 (GRCm39) missense probably null 0.94
R7842:Egflam UTSW 15 7,280,675 (GRCm39) missense probably null 1.00
R8011:Egflam UTSW 15 7,276,525 (GRCm39) missense possibly damaging 0.89
R8080:Egflam UTSW 15 7,427,561 (GRCm39) missense probably benign 0.09
R8175:Egflam UTSW 15 7,241,633 (GRCm39) missense probably damaging 1.00
R8300:Egflam UTSW 15 7,283,932 (GRCm39) missense possibly damaging 0.77
R8553:Egflam UTSW 15 7,237,229 (GRCm39) missense probably damaging 1.00
R8880:Egflam UTSW 15 7,267,249 (GRCm39) missense probably damaging 0.98
R9076:Egflam UTSW 15 7,237,155 (GRCm39) missense probably damaging 1.00
R9216:Egflam UTSW 15 7,281,942 (GRCm39) missense probably benign 0.02
R9518:Egflam UTSW 15 7,319,263 (GRCm39) critical splice donor site probably null
R9557:Egflam UTSW 15 7,241,656 (GRCm39) missense probably damaging 1.00
R9800:Egflam UTSW 15 7,279,525 (GRCm39) missense probably benign 0.01
X0024:Egflam UTSW 15 7,333,494 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCTTGTTGGTAAAGGTGC -3'
(R):5'- CTGAGACCACTAGCCAAGTC -3'

Sequencing Primer
(F):5'- CTCAGGGAGTGGACAGTATCACC -3'
(R):5'- GACCACTAGCCAAGTCTAGTTGTG -3'
Posted On 2022-11-14