Incidental Mutation 'R9745:Fchsd1'
ID 732077
Institutional Source Beutler Lab
Gene Symbol Fchsd1
Ensembl Gene ENSMUSG00000038524
Gene Name FCH and double SH3 domains 1
Synonyms A030002D08Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R9745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 38090484-38102827 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 38102425 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 34 (D34E)
Ref Sequence ENSEMBL: ENSMUSP00000047878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944] [ENSMUST00000043437] [ENSMUST00000163131] [ENSMUST00000164222] [ENSMUST00000166148]
AlphaFold Q6PFY1
Predicted Effect probably benign
Transcript: ENSMUST00000042944
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043437
AA Change: D34E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524
AA Change: D34E

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163131
AA Change: D34E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000133058
Gene: ENSMUSG00000038524
AA Change: D34E

DomainStartEndE-ValueType
Pfam:FCH 12 107 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164222
AA Change: D34E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128481
Gene: ENSMUSG00000038524
AA Change: D34E

DomainStartEndE-ValueType
Pfam:FCH 12 56 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166148
AA Change: D34E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129825
Gene: ENSMUSG00000038524
AA Change: D34E

DomainStartEndE-ValueType
Pfam:FCH 12 93 1.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 T A 10: 126,919,380 (GRCm39) H488Q unknown Het
Ces1b T C 8: 93,790,625 (GRCm39) D388G probably benign Het
Ces1f T C 8: 93,989,740 (GRCm39) D392G probably benign Het
Ces5a A G 8: 94,228,814 (GRCm39) V472A probably damaging Het
Chst1 A G 2: 92,444,047 (GRCm39) D173G possibly damaging Het
Cngb1 T G 8: 95,967,919 (GRCm39) E1294A unknown Het
Cnmd T C 14: 79,887,850 (GRCm39) I124V possibly damaging Het
Cntnap2 A T 6: 46,211,100 (GRCm39) M505L probably benign Het
Cntnap4 T A 8: 113,391,808 (GRCm39) M91K possibly damaging Het
Cstad A G 2: 30,498,197 (GRCm39) T11A unknown Het
Cyp2j6 A T 4: 96,441,621 (GRCm39) V23E possibly damaging Het
Dapk3 C A 10: 81,028,594 (GRCm39) T388K unknown Het
Dennd6a G A 14: 26,320,818 (GRCm39) G120R possibly damaging Het
Disp1 A C 1: 182,869,310 (GRCm39) S1037A probably damaging Het
Dpcd A T 19: 45,560,881 (GRCm39) Q103L probably benign Het
Egfem1 A T 3: 29,716,532 (GRCm39) D334V probably damaging Het
Egflam C T 15: 7,333,419 (GRCm39) V178M probably benign Het
Ehbp1 T C 11: 22,096,692 (GRCm39) T291A probably benign Het
Eif5b G T 1: 38,084,729 (GRCm39) V859F probably damaging Het
Fam161a A T 11: 22,973,495 (GRCm39) Q459L possibly damaging Het
Fcgrt A C 7: 44,742,754 (GRCm39) D342E probably damaging Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Galt A T 4: 41,758,185 (GRCm39) M317L possibly damaging Het
Gfm1 A G 3: 67,358,657 (GRCm39) D416G possibly damaging Het
Glcci1 A T 6: 8,573,278 (GRCm39) I256L probably benign Het
Ibtk C T 9: 85,613,280 (GRCm39) G228S probably benign Het
Ift70b T C 2: 75,768,261 (GRCm39) Y164C probably benign Het
Il2rb T A 15: 78,372,399 (GRCm39) D106V probably benign Het
Map3k6 A T 4: 132,979,783 (GRCm39) I1261F probably damaging Het
Mast2 A G 4: 116,167,815 (GRCm39) L1014P probably benign Het
Mcm2 G A 6: 88,868,729 (GRCm39) Q343* probably null Het
Megf8 A G 7: 25,058,133 (GRCm39) T2136A possibly damaging Het
Mmp28 G A 11: 83,342,283 (GRCm39) T103I probably benign Het
Mtif2 G A 11: 29,476,587 (GRCm39) probably benign Het
Mtus2 A T 5: 148,013,311 (GRCm39) T35S possibly damaging Het
Ncoa2 A T 1: 13,245,192 (GRCm39) I502N probably benign Het
Nek5 A C 8: 22,573,479 (GRCm39) D492E probably benign Het
Nin T C 12: 70,089,899 (GRCm39) E1172G Het
Nsmaf T A 4: 6,416,662 (GRCm39) I544F possibly damaging Het
Oas3 T C 5: 120,899,284 (GRCm39) D763G unknown Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or4s2 T A 2: 88,473,310 (GRCm39) F66L probably benign Het
Or51r1 A T 7: 102,227,861 (GRCm39) D53V probably damaging Het
Or5al6 C T 2: 85,976,251 (GRCm39) V276M probably damaging Het
Or5aq1 T A 2: 86,965,783 (GRCm39) N294I probably damaging Het
Or5k15 A T 16: 58,710,265 (GRCm39) L106Q probably damaging Het
Or5t17 T C 2: 86,832,487 (GRCm39) V58A probably benign Het
Pcdh7 T C 5: 57,879,622 (GRCm39) probably null Het
Pitx3 A G 19: 46,124,660 (GRCm39) S236P possibly damaging Het
Plscr5 T A 9: 92,087,502 (GRCm39) I157N probably damaging Het
Potefam1 T C 2: 111,000,008 (GRCm39) M201V unknown Het
Preb T C 5: 31,116,732 (GRCm39) N54D probably benign Het
Pskh1 C T 8: 106,656,404 (GRCm39) A360V possibly damaging Het
Ptprk T C 10: 28,139,608 (GRCm39) L111S possibly damaging Het
Reln T A 5: 22,152,525 (GRCm39) I2314F probably damaging Het
Siglecg A G 7: 43,067,476 (GRCm39) D681G probably damaging Het
Snx5 A G 2: 144,096,716 (GRCm39) V283A probably benign Het
Srpk2 C A 5: 23,880,874 (GRCm39) probably benign Het
Tacr1 T C 6: 82,469,619 (GRCm39) Y168H possibly damaging Het
Tal1 G T 4: 114,920,557 (GRCm39) R77L probably benign Het
Tdrd12 T C 7: 35,185,964 (GRCm39) probably null Het
Tdrd7 A T 4: 45,994,310 (GRCm39) N236I possibly damaging Het
Tdrd9 T C 12: 112,009,130 (GRCm39) F1012S probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tert T A 13: 73,784,609 (GRCm39) L685Q probably damaging Het
Th T G 7: 142,448,851 (GRCm39) D342A probably damaging Het
Tpsg1 G T 17: 25,591,492 (GRCm39) V31L probably damaging Het
Traf3ip1 C G 1: 91,439,095 (GRCm39) S337* probably null Het
Trpv6 A G 6: 41,600,003 (GRCm39) F551S probably damaging Het
Urah A G 7: 140,415,531 (GRCm39) N23D probably benign Het
Vangl1 A C 3: 102,072,669 (GRCm39) probably null Het
Zc3h6 A G 2: 128,859,155 (GRCm39) E1062G probably benign Het
Zfp37 A T 4: 62,110,644 (GRCm39) V181E possibly damaging Het
Zfp638 T A 6: 83,921,795 (GRCm39) S641T probably benign Het
Zkscan16 A T 4: 58,957,473 (GRCm39) H585L possibly damaging Het
Other mutations in Fchsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Fchsd1 APN 18 38,098,946 (GRCm39) intron probably benign
IGL01097:Fchsd1 APN 18 38,100,810 (GRCm39) splice site probably null
IGL02069:Fchsd1 APN 18 38,100,667 (GRCm39) nonsense probably null
R0015:Fchsd1 UTSW 18 38,096,012 (GRCm39) missense probably benign 0.05
R0015:Fchsd1 UTSW 18 38,096,012 (GRCm39) missense probably benign 0.05
R0755:Fchsd1 UTSW 18 38,101,803 (GRCm39) splice site probably null
R1524:Fchsd1 UTSW 18 38,098,950 (GRCm39) critical splice donor site probably null
R2041:Fchsd1 UTSW 18 38,100,729 (GRCm39) critical splice acceptor site probably null
R3820:Fchsd1 UTSW 18 38,102,510 (GRCm39) splice site probably benign
R3821:Fchsd1 UTSW 18 38,102,510 (GRCm39) splice site probably benign
R4998:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5017:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5018:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5022:Fchsd1 UTSW 18 38,097,863 (GRCm39) missense possibly damaging 0.80
R5023:Fchsd1 UTSW 18 38,097,863 (GRCm39) missense possibly damaging 0.80
R5047:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5240:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5309:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5312:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5353:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5354:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5355:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5424:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5517:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5518:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5521:Fchsd1 UTSW 18 38,099,537 (GRCm39) missense probably damaging 1.00
R5590:Fchsd1 UTSW 18 38,094,380 (GRCm39) missense probably damaging 1.00
R5607:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5608:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5810:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5828:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5906:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5949:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5958:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R5969:Fchsd1 UTSW 18 38,092,926 (GRCm39) unclassified probably benign
R6245:Fchsd1 UTSW 18 38,095,828 (GRCm39) missense probably damaging 1.00
R6322:Fchsd1 UTSW 18 38,098,753 (GRCm39) missense probably benign 0.00
R6433:Fchsd1 UTSW 18 38,097,137 (GRCm39) missense possibly damaging 0.91
R6439:Fchsd1 UTSW 18 38,102,487 (GRCm39) missense probably damaging 0.97
R6460:Fchsd1 UTSW 18 38,092,897 (GRCm39) splice site probably null
R6488:Fchsd1 UTSW 18 38,100,321 (GRCm39) splice site probably null
R6650:Fchsd1 UTSW 18 38,099,555 (GRCm39) nonsense probably null
R7331:Fchsd1 UTSW 18 38,101,823 (GRCm39) missense possibly damaging 0.95
R7715:Fchsd1 UTSW 18 38,099,695 (GRCm39) splice site probably null
R7962:Fchsd1 UTSW 18 38,097,212 (GRCm39) missense probably damaging 0.97
R8140:Fchsd1 UTSW 18 38,097,395 (GRCm39) missense probably damaging 1.00
R8398:Fchsd1 UTSW 18 38,099,577 (GRCm39) missense probably damaging 1.00
R8536:Fchsd1 UTSW 18 38,100,823 (GRCm39) missense probably benign 0.24
R8747:Fchsd1 UTSW 18 38,096,035 (GRCm39) missense probably benign
R9209:Fchsd1 UTSW 18 38,092,706 (GRCm39) missense unknown
X0024:Fchsd1 UTSW 18 38,102,444 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAAGGGGCTCTCTATGTATG -3'
(R):5'- AAACAGCCCAGCCTCTTTCG -3'

Sequencing Primer
(F):5'- TATAGCTCCAGTATCTGAAGAGGC -3'
(R):5'- CAGCCTCTTTCGGGCCC -3'
Posted On 2022-11-14