Incidental Mutation 'R9746:Nup188'
ID 732088
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Name nucleoporin 188
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 30176419-30234278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30194300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 158 (Y158N)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447] [ENSMUST00000113634] [ENSMUST00000138666] [ENSMUST00000148969]
AlphaFold Q6ZQH8
Predicted Effect probably damaging
Transcript: ENSMUST00000064447
AA Change: Y158N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: Y158N

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113634
SMART Domains Protein: ENSMUSP00000109264
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 128 1.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138666
SMART Domains Protein: ENSMUSP00000122398
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 118 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143119
SMART Domains Protein: ENSMUSP00000125607
Gene: ENSMUSG00000098794

DomainStartEndE-ValueType
PDB:3OBZ|A 1 31 4e-9 PDB
Pfam:Nup188 47 126 2.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148969
SMART Domains Protein: ENSMUSP00000121742
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 115 1.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30,223,412 (GRCm39) missense probably damaging 0.98
IGL01599:Nup188 APN 2 30,217,537 (GRCm39) missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30,219,371 (GRCm39) missense probably benign
IGL01973:Nup188 APN 2 30,229,862 (GRCm39) missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30,219,385 (GRCm39) nonsense probably null
IGL02221:Nup188 APN 2 30,220,653 (GRCm39) missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30,216,523 (GRCm39) missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30,213,648 (GRCm39) critical splice donor site probably null
IGL02986:Nup188 APN 2 30,197,645 (GRCm39) splice site probably null
IGL03029:Nup188 APN 2 30,212,592 (GRCm39) splice site probably benign
IGL03194:Nup188 APN 2 30,194,346 (GRCm39) missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30,230,653 (GRCm39) missense possibly damaging 0.52
core UTSW 2 30,229,906 (GRCm39) missense probably damaging 1.00
kern UTSW 2 30,227,045 (GRCm39) missense possibly damaging 0.94
P0027:Nup188 UTSW 2 30,212,693 (GRCm39) missense probably damaging 0.99
R0006:Nup188 UTSW 2 30,212,035 (GRCm39) missense probably benign 0.27
R0360:Nup188 UTSW 2 30,216,491 (GRCm39) missense probably null 0.93
R0373:Nup188 UTSW 2 30,221,000 (GRCm39) missense probably damaging 1.00
R0645:Nup188 UTSW 2 30,233,478 (GRCm39) splice site probably null
R1411:Nup188 UTSW 2 30,233,807 (GRCm39) missense probably benign 0.01
R1670:Nup188 UTSW 2 30,230,667 (GRCm39) missense probably benign 0.19
R2034:Nup188 UTSW 2 30,200,097 (GRCm39) unclassified probably benign
R2113:Nup188 UTSW 2 30,194,113 (GRCm39) nonsense probably null
R2142:Nup188 UTSW 2 30,226,718 (GRCm39) missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30,226,936 (GRCm39) splice site probably benign
R2567:Nup188 UTSW 2 30,231,794 (GRCm39) missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30,215,358 (GRCm39) missense probably damaging 0.98
R4006:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4007:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4079:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4480:Nup188 UTSW 2 30,212,141 (GRCm39) intron probably benign
R4628:Nup188 UTSW 2 30,219,358 (GRCm39) missense probably damaging 1.00
R4687:Nup188 UTSW 2 30,220,645 (GRCm39) missense probably benign 0.01
R4814:Nup188 UTSW 2 30,216,523 (GRCm39) missense possibly damaging 0.95
R4834:Nup188 UTSW 2 30,229,596 (GRCm39) missense probably damaging 1.00
R5038:Nup188 UTSW 2 30,199,232 (GRCm39) missense probably damaging 0.98
R5056:Nup188 UTSW 2 30,194,143 (GRCm39) missense probably damaging 0.98
R5124:Nup188 UTSW 2 30,220,947 (GRCm39) missense probably damaging 1.00
R5256:Nup188 UTSW 2 30,220,761 (GRCm39) missense probably damaging 1.00
R5284:Nup188 UTSW 2 30,220,647 (GRCm39) missense probably damaging 1.00
R5548:Nup188 UTSW 2 30,216,505 (GRCm39) missense probably damaging 0.99
R5560:Nup188 UTSW 2 30,199,897 (GRCm39) missense probably damaging 0.99
R5668:Nup188 UTSW 2 30,226,336 (GRCm39) missense probably damaging 1.00
R5769:Nup188 UTSW 2 30,220,747 (GRCm39) missense probably benign 0.34
R5773:Nup188 UTSW 2 30,212,208 (GRCm39) missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30,191,060 (GRCm39) missense probably damaging 1.00
R5827:Nup188 UTSW 2 30,229,859 (GRCm39) missense probably damaging 1.00
R5919:Nup188 UTSW 2 30,229,906 (GRCm39) missense probably damaging 1.00
R5923:Nup188 UTSW 2 30,194,102 (GRCm39) missense probably benign
R6185:Nup188 UTSW 2 30,231,722 (GRCm39) missense probably damaging 0.97
R6457:Nup188 UTSW 2 30,212,199 (GRCm39) missense probably damaging 0.98
R6529:Nup188 UTSW 2 30,216,466 (GRCm39) missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30,213,580 (GRCm39) missense probably damaging 0.99
R7195:Nup188 UTSW 2 30,231,842 (GRCm39) critical splice donor site probably null
R7214:Nup188 UTSW 2 30,197,566 (GRCm39) missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30,230,613 (GRCm39) missense probably benign 0.09
R7853:Nup188 UTSW 2 30,213,575 (GRCm39) missense possibly damaging 0.95
R7998:Nup188 UTSW 2 30,220,983 (GRCm39) missense probably damaging 1.00
R8012:Nup188 UTSW 2 30,227,277 (GRCm39) missense possibly damaging 0.95
R8080:Nup188 UTSW 2 30,227,045 (GRCm39) missense possibly damaging 0.94
R8804:Nup188 UTSW 2 30,220,891 (GRCm39) missense probably benign
R8850:Nup188 UTSW 2 30,217,576 (GRCm39) missense probably damaging 0.99
R9110:Nup188 UTSW 2 30,222,461 (GRCm39) missense possibly damaging 0.94
R9157:Nup188 UTSW 2 30,188,456 (GRCm39) missense probably benign 0.02
R9209:Nup188 UTSW 2 30,232,397 (GRCm39) missense probably benign 0.02
R9287:Nup188 UTSW 2 30,226,726 (GRCm39) missense probably damaging 0.99
R9325:Nup188 UTSW 2 30,212,271 (GRCm39) missense probably damaging 0.99
R9390:Nup188 UTSW 2 30,220,777 (GRCm39) critical splice donor site probably null
R9607:Nup188 UTSW 2 30,197,724 (GRCm39) missense probably benign 0.01
R9768:Nup188 UTSW 2 30,227,045 (GRCm39) missense probably damaging 0.99
T0722:Nup188 UTSW 2 30,212,693 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGAACCTGCATTCTTCGTTG -3'
(R):5'- GTATGTAACTCCACCAGGGC -3'

Sequencing Primer
(F):5'- ACACCTTCTGACATATTTCCAAGATG -3'
(R):5'- GCTCCCTGAACAAGGCATG -3'
Posted On 2022-11-14