Mutagenetix > Incidental Mutation

Incidental Mutation 'R9746:Trpm7'

732094

Institutional Source

Beutler Lab

Gene Symbol

Trpm7

Ensembl Gene

ENSMUSG00000027365

Gene Name

transient receptor potential cation channel, subfamily M, member 7

Synonyms

LTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9746 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126791565-126876230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126822658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 934 (S934P)

Ref Sequence

ENSEMBL: ENSMUSP00000099513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]

AlphaFold

Q923J1

PDB Structure

CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028843
AA Change: S934P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: S934P

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
Pfam:Ion_trans	887	1096	3e-8	PFAM
PDB:3E7K\|H	1198	1249	6e-27	PDB
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1545	6e-64	BLAST
Alpha_kinase	1596	1813	3.77e-89	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103224
AA Change: S934P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: S934P

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
Pfam:Ion_trans	855	1108	1.7e-9	PFAM
Pfam:TRPM_tetra	1194	1249	3.3e-29	PFAM
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1546	2e-64	BLAST
Alpha_kinase	1597	1814	3.77e-89	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	T	A	1: 173,332,031	H307L	probably benign	Het
Acnat1	A	T	4: 49,450,652	L153H	probably damaging	Het
Actn4	A	T	7: 28,919,006	D76E	probably benign	Het
Afdn	A	C	17: 13,846,520	M640L	probably benign	Het
Angpt1	A	T	15: 42,676,441	F7L	probably benign	Het
Ap3b2	A	G	7: 81,476,344	F373S	probably damaging	Het
Armc2	T	A	10: 41,924,461	Y650F	probably damaging	Het
Atg2b	G	T	12: 105,663,938	T398K	possibly damaging	Het
Baz1a	CCATT	CCATTCATT	12: 54,975,110		probably null	Het
Capn8	G	A	1: 182,611,105		probably null	Het
Cdr1	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	X: 61,184,524		probably benign	Het
Cfap54	T	C	10: 92,801,219	N3103D	probably benign	Het
Chd9	G	A	8: 91,011,435	R1565Q	unknown	Het
Cir1	G	A	2: 73,303,808	T139I	probably damaging	Het
Cmah	T	C	13: 24,435,690		probably null	Het
Cnpy1	T	C	5: 28,245,802	D2G	probably damaging	Het
Dennd4a	A	T	9: 64,894,511	T979S	probably benign	Het
Dnah11	T	A	12: 117,878,576	K4423*	probably null	Het
Dnajb4	A	G	3: 152,186,683	I171T	possibly damaging	Het
Dpm1	A	T	2: 168,230,387		probably null	Het
Dtwd1	A	G	2: 126,154,675	T27A	probably benign	Het
Ep400	C	T	5: 110,742,006	D464N	unknown	Het
Epb42	A	T	2: 121,024,610	I498N	probably benign	Het
Fhod1	A	G	8: 105,337,416	V219A	unknown	Het
Gabrb2	A	T	11: 42,626,609	E419D	probably benign	Het
Galnt18	A	T	7: 111,471,961	N615K	possibly damaging	Het
Gm13084	T	C	4: 143,810,316	T482A	probably benign	Het
Gm29106	T	A	1: 118,199,524	H315Q	possibly damaging	Het
Gprin2	G	T	14: 34,195,658	Q52K	probably benign	Het
Grm4	A	T	17: 27,438,791	Y414N	probably damaging	Het
Gulo	C	A	14: 65,988,181		probably null	Het
H2-M1	A	C	17: 36,670,105	V313G	possibly damaging	Het
Hectd3	T	C	4: 116,995,754	W118R	probably damaging	Het
Hs6st3	G	A	14: 119,869,080	C300Y	probably damaging	Het
Il1rl2	T	A	1: 40,365,359	S547T	possibly damaging	Het
Kank1	G	T	19: 25,409,508	V182F	probably damaging	Het
Kif20b	T	A	19: 34,950,749	L1137*	probably null	Het
Klhl7	A	G	5: 24,126,820		probably null	Het
Krt13	T	A	11: 100,121,161	D112V	possibly damaging	Het
Ltbr	A	G	6: 125,313,101	V71A	probably benign	Het
Ly6g	T	C	15: 75,158,609	V92A	probably benign	Het
Map2k3	G	A	11: 60,932,103		probably benign	Het
Mast2	A	C	4: 116,311,730	D842E	probably benign	Het
Mpo	T	G	11: 87,803,523	M693R	probably benign	Het
Myo15	C	A	11: 60,487,408	S212*	probably null	Het
Nadk2	C	T	15: 9,106,736	R37*	probably null	Het
Ncapd3	G	A	9: 27,063,359	R709H	probably benign	Het
Nck2	T	A	1: 43,533,732	Y55*	probably null	Het
Neurl4	A	G	11: 69,907,475	D777G	probably damaging	Het
Npr2	G	A	4: 43,633,527	V224M	possibly damaging	Het
Nptx2	T	A	5: 144,548,140	S148T	probably benign	Het
Nr1d1	T	C	11: 98,770,334	T369A	probably benign	Het
Nub1	T	G	5: 24,703,485	F411V	probably damaging	Het
Nup188	T	A	2: 30,304,288	Y158N	probably damaging	Het
Olfr1031	A	G	2: 85,992,747	Y310C	probably benign	Het
Olfr513	A	G	7: 108,755,432	N192S	probably benign	Het
Olfr716	A	T	7: 107,147,453	I46F	probably benign	Het
Olfr804	A	T	10: 129,705,339	I154F	probably damaging	Het
Olfr897-ps1	T	A	9: 38,309,632	I279K	unknown	Het
Orc2	C	T	1: 58,497,451	G85S	probably damaging	Het
Pak1ip1	T	A	13: 41,009,267	V182D	probably damaging	Het
Parvg	T	G	15: 84,326,223	C30W	probably benign	Het
Pcdha1	T	A	18: 36,932,660	D792E	probably benign	Het
Ppp1r13b	G	T	12: 111,833,808	Q635K	probably benign	Het
Psg16	A	G	7: 17,098,161	I341V	probably benign	Het
Psme4	C	T	11: 30,876,868	Q1796*	probably null	Het
Ptn	T	G	6: 36,715,764		probably null	Het
Rapsn	C	T	2: 91,045,478	P400L	probably damaging	Het
Rasal1	G	A	5: 120,662,293	G207D	probably damaging	Het
Rdx	A	G	9: 52,063,578	I5V	probably benign	Het
Rpf1	A	G	3: 146,517,778	I105T	probably damaging	Het
Rps15a	A	T	7: 118,109,997	F79I	possibly damaging	Het
Rwdd2b	G	A	16: 87,436,753	P153L	probably benign	Het
Scaf11	G	A	15: 96,420,417	S422L	probably damaging	Het
Serpinb3b	T	A	1: 107,154,673	E287V	possibly damaging	Het
Sgta	T	C	10: 81,051,284	D49G	possibly damaging	Het
Sin3a	T	A	9: 57,118,074	M1068K	probably benign	Het
Slc12a9	G	A	5: 137,321,409	R615W	probably damaging	Het
Slc26a3	T	A	12: 31,449,146	S151T	probably benign	Het
Slc4a8	C	A	15: 100,783,840	H111N	probably damaging	Het
Syngr1	G	A	15: 80,091,458	R22K	probably benign	Het
Tars2	A	T	3: 95,754,765	V25E	probably benign	Het
Tbx15	A	G	3: 99,352,331	Y506C	probably damaging	Het
Tgm4	A	T	9: 123,046,569	K162N	possibly damaging	Het
Tmem253	A	G	14: 52,017,982	E83G	probably damaging	Het
Trp73	G	A	4: 154,081,402	T118I	probably damaging	Het
Ttc23l	G	A	15: 10,523,643	S330L	probably benign	Het
Tub	A	C	7: 109,025,638	D199A	probably benign	Het
Uri1	A	C	7: 37,996,685		probably null	Het
Usp16	C	T	16: 87,479,232	A486V	probably benign	Het
Vmn1r12	A	G	6: 57,159,541	I208V	probably benign	Het
Vmn2r116	A	T	17: 23,401,823	M844L	probably benign	Het
Vmn2r13	C	T	5: 109,191,907		probably null	Het
Xpnpep1	T	C	19: 53,013,461	D118G	probably damaging	Het
Zfp111	G	A	7: 24,198,642	P516S	possibly damaging	Het

Other mutations in Trpm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Trpm7	APN	2	126829031	missense	possibly damaging	0.82
IGL01084:Trpm7	APN	2	126846072	critical splice donor site	probably null
IGL01634:Trpm7	APN	2	126826818	missense	probably damaging	1.00
IGL01678:Trpm7	APN	2	126816799	missense	probably damaging	0.99
IGL02005:Trpm7	APN	2	126813184	missense	probably damaging	0.97
IGL02064:Trpm7	APN	2	126797943	missense	probably damaging	1.00
IGL02156:Trpm7	APN	2	126799243	unclassified	probably benign
IGL02172:Trpm7	APN	2	126795328	missense	possibly damaging	0.94
IGL02334:Trpm7	APN	2	126807362	missense	probably benign
IGL02375:Trpm7	APN	2	126825744	missense	probably damaging	1.00
IGL02388:Trpm7	APN	2	126819891	missense	possibly damaging	0.80
IGL02552:Trpm7	APN	2	126840779	missense	probably damaging	1.00
IGL02684:Trpm7	APN	2	126846159	missense	probably damaging	0.99
IGL02901:Trpm7	APN	2	126807287	critical splice donor site	probably null
Accused	UTSW	2	126826737	missense	probably damaging	0.99
Condemned	UTSW	2	126835508	missense	probably damaging	1.00
denounced	UTSW	2	126813021	missense	probably benign	0.00
deposed	UTSW	2	126797498	missense	probably benign	0.01
Summac	UTSW	2	126819963	missense	probably damaging	1.00
Vacated	UTSW	2	126849922	missense	probably damaging	1.00
P0037:Trpm7	UTSW	2	126816757	splice site	probably benign
R0038:Trpm7	UTSW	2	126795468	missense	probably damaging	1.00
R0139:Trpm7	UTSW	2	126812771	missense	probably benign
R0165:Trpm7	UTSW	2	126797513	missense	probably damaging	0.97
R0511:Trpm7	UTSW	2	126826718	nonsense	probably null
R0543:Trpm7	UTSW	2	126848529	missense	probably damaging	1.00
R0784:Trpm7	UTSW	2	126846072	critical splice donor site	probably null
R0844:Trpm7	UTSW	2	126835508	missense	probably damaging	1.00
R0865:Trpm7	UTSW	2	126799239	splice site	probably null
R0919:Trpm7	UTSW	2	126831238	missense	probably damaging	1.00
R0972:Trpm7	UTSW	2	126805049	missense	probably benign
R1109:Trpm7	UTSW	2	126797793	missense	probably benign	0.01
R1118:Trpm7	UTSW	2	126822486	missense	possibly damaging	0.63
R1278:Trpm7	UTSW	2	126825454	nonsense	probably null
R1527:Trpm7	UTSW	2	126830162	missense	probably benign	0.18
R1542:Trpm7	UTSW	2	126822599	nonsense	probably null
R1882:Trpm7	UTSW	2	126812777	missense	probably benign	0.00
R1951:Trpm7	UTSW	2	126831299	missense	probably damaging	1.00
R2011:Trpm7	UTSW	2	126823997	nonsense	probably null
R2012:Trpm7	UTSW	2	126823997	nonsense	probably null
R2026:Trpm7	UTSW	2	126812738	missense	probably benign	0.39
R2067:Trpm7	UTSW	2	126797727	missense	probably damaging	1.00
R2926:Trpm7	UTSW	2	126858409	splice site	probably benign
R3082:Trpm7	UTSW	2	126844422	missense	possibly damaging	0.90
R3552:Trpm7	UTSW	2	126826710	splice site	probably benign
R3607:Trpm7	UTSW	2	126796428	intron	probably benign
R3739:Trpm7	UTSW	2	126851521	missense	probably damaging	1.00
R3943:Trpm7	UTSW	2	126831218	missense	possibly damaging	0.94
R4161:Trpm7	UTSW	2	126816831	missense	probably damaging	1.00
R4176:Trpm7	UTSW	2	126829163	missense	possibly damaging	0.83
R4392:Trpm7	UTSW	2	126795509	splice site	probably null
R4392:Trpm7	UTSW	2	126848538	missense	probably damaging	1.00
R4404:Trpm7	UTSW	2	126833715	missense	probably damaging	0.97
R4574:Trpm7	UTSW	2	126797211	missense	probably benign	0.01
R4714:Trpm7	UTSW	2	126840783	nonsense	probably null
R4807:Trpm7	UTSW	2	126831229	missense	probably benign	0.00
R4815:Trpm7	UTSW	2	126858492	missense	probably damaging	1.00
R4846:Trpm7	UTSW	2	126813185	missense	possibly damaging	0.63
R4972:Trpm7	UTSW	2	126824058	missense	probably damaging	1.00
R5097:Trpm7	UTSW	2	126796336	critical splice donor site	probably null
R5263:Trpm7	UTSW	2	126821217	missense	probably benign	0.34
R5361:Trpm7	UTSW	2	126829241	missense	possibly damaging	0.77
R5377:Trpm7	UTSW	2	126842855	critical splice donor site	probably null
R5574:Trpm7	UTSW	2	126813030	missense	probably benign
R5782:Trpm7	UTSW	2	126797714	missense	probably benign	0.04
R5840:Trpm7	UTSW	2	126822611	nonsense	probably null
R6044:Trpm7	UTSW	2	126814745	missense	probably damaging	1.00
R6178:Trpm7	UTSW	2	126837381	missense	probably damaging	1.00
R6196:Trpm7	UTSW	2	126825639	missense	possibly damaging	0.66
R6457:Trpm7	UTSW	2	126807294	missense	probably benign
R6530:Trpm7	UTSW	2	126812711	missense	probably damaging	1.00
R6764:Trpm7	UTSW	2	126844420	missense	possibly damaging	0.79
R6841:Trpm7	UTSW	2	126813021	missense	probably benign	0.00
R6868:Trpm7	UTSW	2	126837414	missense	probably damaging	1.00
R7250:Trpm7	UTSW	2	126826765	missense	possibly damaging	0.87
R7402:Trpm7	UTSW	2	126799206	missense	probably damaging	1.00
R7451:Trpm7	UTSW	2	126826737	missense	probably damaging	0.99
R7486:Trpm7	UTSW	2	126831195	critical splice donor site	probably null
R7509:Trpm7	UTSW	2	126849922	missense	probably damaging	1.00
R7586:Trpm7	UTSW	2	126810165	missense	probably benign
R7774:Trpm7	UTSW	2	126813238	missense	probably benign	0.09
R7793:Trpm7	UTSW	2	126824075	nonsense	probably null
R7812:Trpm7	UTSW	2	126799316	missense	probably damaging	1.00
R7900:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R7951:Trpm7	UTSW	2	126813268	missense	possibly damaging	0.94
R7965:Trpm7	UTSW	2	126825694	missense	probably damaging	0.99
R7992:Trpm7	UTSW	2	126825534	missense	probably benign
R8034:Trpm7	UTSW	2	126846199	missense	probably damaging	0.98
R8199:Trpm7	UTSW	2	126849998	missense	probably damaging	1.00
R8304:Trpm7	UTSW	2	126797877	missense	probably damaging	1.00
R8405:Trpm7	UTSW	2	126816835	missense	probably benign	0.26
R8674:Trpm7	UTSW	2	126799166	unclassified	probably benign
R8742:Trpm7	UTSW	2	126825549	missense	probably damaging	1.00
R8754:Trpm7	UTSW	2	126822703	missense	probably damaging	1.00
R8842:Trpm7	UTSW	2	126821211	missense	probably benign	0.05
R8850:Trpm7	UTSW	2	126810180	missense	probably benign	0.00
R8881:Trpm7	UTSW	2	126819963	missense	probably damaging	1.00
R8898:Trpm7	UTSW	2	126822741	missense	possibly damaging	0.92
R9339:Trpm7	UTSW	2	126823986	missense	probably benign	0.04
R9428:Trpm7	UTSW	2	126829220	missense	probably damaging	1.00
R9446:Trpm7	UTSW	2	126830265	critical splice acceptor site	probably null
R9568:Trpm7	UTSW	2	126822590	missense	probably benign	0.02
R9647:Trpm7	UTSW	2	126825642	missense	probably damaging	1.00
R9678:Trpm7	UTSW	2	126844370	missense	probably damaging	1.00
X0026:Trpm7	UTSW	2	126829290	missense	probably benign
Z1088:Trpm7	UTSW	2	126797281	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGGCCAGGTAAAGCTATATG -3'
(R):5'- TCCTGTGAAGTTATAATCAGCTCC -3'

Sequencing Primer
(F):5'- CCAATCATCATTACATAAGGTCCTG -3'
(R):5'- AGCTGGGAAAATCAGCCA -3'

Posted On

2022-11-14