Incidental Mutation 'R9746:Trpm7'
ID 732094
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Name transient receptor potential cation channel, subfamily M, member 7
Synonyms CHAK, 5033407O22Rik, TRP-PLIK, 4833414K03Rik, CHAK1, LTRPC7, Ltpr7, 2310022G15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 126633485-126718150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126664578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 934 (S934P)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
AlphaFold Q923J1
PDB Structure CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028843
AA Change: S934P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: S934P

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103224
AA Change: S934P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: S934P

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126,670,951 (GRCm39) missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126,687,992 (GRCm39) critical splice donor site probably null
IGL01634:Trpm7 APN 2 126,668,738 (GRCm39) missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126,658,719 (GRCm39) missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126,655,104 (GRCm39) missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126,639,863 (GRCm39) missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126,641,163 (GRCm39) unclassified probably benign
IGL02172:Trpm7 APN 2 126,637,248 (GRCm39) missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126,649,282 (GRCm39) missense probably benign
IGL02375:Trpm7 APN 2 126,667,664 (GRCm39) missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126,661,811 (GRCm39) missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126,682,699 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126,688,079 (GRCm39) missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126,649,207 (GRCm39) critical splice donor site probably null
Accused UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
Condemned UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
denounced UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
deposed UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
Summac UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
Vacated UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
P0037:Trpm7 UTSW 2 126,658,677 (GRCm39) splice site probably benign
R0038:Trpm7 UTSW 2 126,637,388 (GRCm39) missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126,654,691 (GRCm39) missense probably benign
R0165:Trpm7 UTSW 2 126,639,433 (GRCm39) missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126,668,638 (GRCm39) nonsense probably null
R0543:Trpm7 UTSW 2 126,690,449 (GRCm39) missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126,687,992 (GRCm39) critical splice donor site probably null
R0844:Trpm7 UTSW 2 126,677,428 (GRCm39) missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126,641,159 (GRCm39) splice site probably null
R0919:Trpm7 UTSW 2 126,673,158 (GRCm39) missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126,646,969 (GRCm39) missense probably benign
R1109:Trpm7 UTSW 2 126,639,713 (GRCm39) missense probably benign 0.01
R1118:Trpm7 UTSW 2 126,664,406 (GRCm39) missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126,667,374 (GRCm39) nonsense probably null
R1527:Trpm7 UTSW 2 126,672,082 (GRCm39) missense probably benign 0.18
R1542:Trpm7 UTSW 2 126,664,519 (GRCm39) nonsense probably null
R1882:Trpm7 UTSW 2 126,654,697 (GRCm39) missense probably benign 0.00
R1951:Trpm7 UTSW 2 126,673,219 (GRCm39) missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2012:Trpm7 UTSW 2 126,665,917 (GRCm39) nonsense probably null
R2026:Trpm7 UTSW 2 126,654,658 (GRCm39) missense probably benign 0.39
R2067:Trpm7 UTSW 2 126,639,647 (GRCm39) missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126,700,329 (GRCm39) splice site probably benign
R3082:Trpm7 UTSW 2 126,686,342 (GRCm39) missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126,668,630 (GRCm39) splice site probably benign
R3607:Trpm7 UTSW 2 126,638,348 (GRCm39) intron probably benign
R3739:Trpm7 UTSW 2 126,693,441 (GRCm39) missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126,673,138 (GRCm39) missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126,658,751 (GRCm39) missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126,671,083 (GRCm39) missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126,690,458 (GRCm39) missense probably damaging 1.00
R4392:Trpm7 UTSW 2 126,637,429 (GRCm39) splice site probably null
R4404:Trpm7 UTSW 2 126,675,635 (GRCm39) missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126,639,131 (GRCm39) missense probably benign 0.01
R4714:Trpm7 UTSW 2 126,682,703 (GRCm39) nonsense probably null
R4807:Trpm7 UTSW 2 126,673,149 (GRCm39) missense probably benign 0.00
R4815:Trpm7 UTSW 2 126,700,412 (GRCm39) missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126,655,105 (GRCm39) missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126,665,978 (GRCm39) missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126,638,256 (GRCm39) critical splice donor site probably null
R5263:Trpm7 UTSW 2 126,663,137 (GRCm39) missense probably benign 0.34
R5361:Trpm7 UTSW 2 126,671,161 (GRCm39) missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126,684,775 (GRCm39) critical splice donor site probably null
R5574:Trpm7 UTSW 2 126,654,950 (GRCm39) missense probably benign
R5782:Trpm7 UTSW 2 126,639,634 (GRCm39) missense probably benign 0.04
R5840:Trpm7 UTSW 2 126,664,531 (GRCm39) nonsense probably null
R6044:Trpm7 UTSW 2 126,656,665 (GRCm39) missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126,679,301 (GRCm39) missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126,667,559 (GRCm39) missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126,649,214 (GRCm39) missense probably benign
R6530:Trpm7 UTSW 2 126,654,631 (GRCm39) missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126,686,340 (GRCm39) missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126,654,941 (GRCm39) missense probably benign 0.00
R6868:Trpm7 UTSW 2 126,679,334 (GRCm39) missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126,668,685 (GRCm39) missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126,641,126 (GRCm39) missense probably damaging 1.00
R7451:Trpm7 UTSW 2 126,668,657 (GRCm39) missense probably damaging 0.99
R7486:Trpm7 UTSW 2 126,673,115 (GRCm39) critical splice donor site probably null
R7509:Trpm7 UTSW 2 126,691,842 (GRCm39) missense probably damaging 1.00
R7586:Trpm7 UTSW 2 126,652,085 (GRCm39) missense probably benign
R7774:Trpm7 UTSW 2 126,655,158 (GRCm39) missense probably benign 0.09
R7793:Trpm7 UTSW 2 126,665,995 (GRCm39) nonsense probably null
R7812:Trpm7 UTSW 2 126,641,236 (GRCm39) missense probably damaging 1.00
R7900:Trpm7 UTSW 2 126,639,418 (GRCm39) missense probably benign 0.01
R7951:Trpm7 UTSW 2 126,655,188 (GRCm39) missense possibly damaging 0.94
R7965:Trpm7 UTSW 2 126,667,614 (GRCm39) missense probably damaging 0.99
R7992:Trpm7 UTSW 2 126,667,454 (GRCm39) missense probably benign
R8034:Trpm7 UTSW 2 126,688,119 (GRCm39) missense probably damaging 0.98
R8199:Trpm7 UTSW 2 126,691,918 (GRCm39) missense probably damaging 1.00
R8304:Trpm7 UTSW 2 126,639,797 (GRCm39) missense probably damaging 1.00
R8405:Trpm7 UTSW 2 126,658,755 (GRCm39) missense probably benign 0.26
R8674:Trpm7 UTSW 2 126,641,086 (GRCm39) unclassified probably benign
R8742:Trpm7 UTSW 2 126,667,469 (GRCm39) missense probably damaging 1.00
R8754:Trpm7 UTSW 2 126,664,623 (GRCm39) missense probably damaging 1.00
R8842:Trpm7 UTSW 2 126,663,131 (GRCm39) missense probably benign 0.05
R8850:Trpm7 UTSW 2 126,652,100 (GRCm39) missense probably benign 0.00
R8881:Trpm7 UTSW 2 126,661,883 (GRCm39) missense probably damaging 1.00
R8898:Trpm7 UTSW 2 126,664,661 (GRCm39) missense possibly damaging 0.92
R9339:Trpm7 UTSW 2 126,665,906 (GRCm39) missense probably benign 0.04
R9428:Trpm7 UTSW 2 126,671,140 (GRCm39) missense probably damaging 1.00
R9446:Trpm7 UTSW 2 126,672,185 (GRCm39) critical splice acceptor site probably null
R9568:Trpm7 UTSW 2 126,664,510 (GRCm39) missense probably benign 0.02
R9647:Trpm7 UTSW 2 126,667,562 (GRCm39) missense probably damaging 1.00
R9678:Trpm7 UTSW 2 126,686,290 (GRCm39) missense probably damaging 1.00
X0026:Trpm7 UTSW 2 126,671,210 (GRCm39) missense probably benign
Z1088:Trpm7 UTSW 2 126,639,201 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCCAGGTAAAGCTATATG -3'
(R):5'- TCCTGTGAAGTTATAATCAGCTCC -3'

Sequencing Primer
(F):5'- CCAATCATCATTACATAAGGTCCTG -3'
(R):5'- AGCTGGGAAAATCAGCCA -3'
Posted On 2022-11-14