Incidental Mutation 'R9746:Mast2'
ID 732102
Institutional Source Beutler Lab
Gene Symbol Mast2
Ensembl Gene ENSMUSG00000003810
Gene Name microtubule associated serine/threonine kinase 2
Synonyms MAST205, Mtssk
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 116163957-116321420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 116168927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 842 (D842E)
Ref Sequence ENSEMBL: ENSMUSP00000102095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000003908
AA Change: D774E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810
AA Change: D774E

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 416 1.8e-148 PFAM
S_TKc 452 725 2.96e-99 SMART
S_TK_X 726 786 1.08e-1 SMART
low complexity region 849 861 N/A INTRINSIC
low complexity region 1009 1028 N/A INTRINSIC
PDZ 1049 1129 2.23e-12 SMART
low complexity region 1142 1157 N/A INTRINSIC
low complexity region 1177 1210 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
low complexity region 1279 1302 N/A INTRINSIC
low complexity region 1345 1360 N/A INTRINSIC
low complexity region 1437 1452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106484
AA Change: D781E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810
AA Change: D781E

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 423 1.3e-151 PFAM
S_TKc 459 732 2.96e-99 SMART
S_TK_X 733 793 1.08e-1 SMART
low complexity region 856 868 N/A INTRINSIC
low complexity region 1016 1035 N/A INTRINSIC
PDZ 1056 1136 2.23e-12 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1184 1217 N/A INTRINSIC
low complexity region 1233 1255 N/A INTRINSIC
low complexity region 1285 1308 N/A INTRINSIC
low complexity region 1351 1366 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106485
AA Change: D835E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810
AA Change: D835E

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 477 1.1e-148 PFAM
S_TKc 513 786 2.96e-99 SMART
S_TK_X 787 847 1.08e-1 SMART
low complexity region 910 922 N/A INTRINSIC
low complexity region 1070 1089 N/A INTRINSIC
PDZ 1110 1190 2.23e-12 SMART
low complexity region 1203 1218 N/A INTRINSIC
low complexity region 1238 1271 N/A INTRINSIC
low complexity region 1285 1310 N/A INTRINSIC
low complexity region 1340 1363 N/A INTRINSIC
low complexity region 1406 1421 N/A INTRINSIC
low complexity region 1498 1513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106486
AA Change: D842E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810
AA Change: D842E

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 483 2.9e-143 PFAM
S_TKc 520 793 2.96e-99 SMART
S_TK_X 794 854 1.08e-1 SMART
low complexity region 917 929 N/A INTRINSIC
low complexity region 1077 1096 N/A INTRINSIC
PDZ 1117 1197 2.23e-12 SMART
low complexity region 1210 1225 N/A INTRINSIC
low complexity region 1245 1278 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1346 1369 N/A INTRINSIC
low complexity region 1412 1427 N/A INTRINSIC
low complexity region 1504 1519 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Mast2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Mast2 APN 4 116,168,526 (GRCm39) missense probably benign 0.39
IGL00916:Mast2 APN 4 116,184,830 (GRCm39) missense possibly damaging 0.88
IGL02112:Mast2 APN 4 116,176,961 (GRCm39) missense probably damaging 1.00
R0645:Mast2 UTSW 4 116,170,043 (GRCm39) splice site probably benign
R0645:Mast2 UTSW 4 116,165,184 (GRCm39) missense probably damaging 1.00
R0883:Mast2 UTSW 4 116,168,964 (GRCm39) missense probably damaging 1.00
R1447:Mast2 UTSW 4 116,169,210 (GRCm39) missense probably benign 0.02
R1449:Mast2 UTSW 4 116,166,210 (GRCm39) missense probably damaging 1.00
R1473:Mast2 UTSW 4 116,169,152 (GRCm39) missense probably damaging 1.00
R1491:Mast2 UTSW 4 116,173,688 (GRCm39) missense possibly damaging 0.90
R1529:Mast2 UTSW 4 116,287,716 (GRCm39) missense probably benign 0.17
R1654:Mast2 UTSW 4 116,173,747 (GRCm39) critical splice acceptor site probably null
R1768:Mast2 UTSW 4 116,164,156 (GRCm39) missense probably damaging 1.00
R1807:Mast2 UTSW 4 116,167,938 (GRCm39) splice site probably benign
R1981:Mast2 UTSW 4 116,172,037 (GRCm39) missense probably damaging 1.00
R2081:Mast2 UTSW 4 116,187,671 (GRCm39) splice site probably null
R2157:Mast2 UTSW 4 116,179,480 (GRCm39) missense probably damaging 1.00
R3409:Mast2 UTSW 4 116,168,107 (GRCm39) missense possibly damaging 0.94
R3411:Mast2 UTSW 4 116,168,107 (GRCm39) missense possibly damaging 0.94
R3434:Mast2 UTSW 4 116,165,292 (GRCm39) missense probably benign 0.00
R3435:Mast2 UTSW 4 116,165,292 (GRCm39) missense probably benign 0.00
R3953:Mast2 UTSW 4 116,170,926 (GRCm39) missense probably damaging 1.00
R4056:Mast2 UTSW 4 116,194,698 (GRCm39) splice site probably benign
R4153:Mast2 UTSW 4 116,173,160 (GRCm39) missense possibly damaging 0.91
R4648:Mast2 UTSW 4 116,172,036 (GRCm39) nonsense probably null
R4671:Mast2 UTSW 4 116,165,847 (GRCm39) missense probably damaging 1.00
R4911:Mast2 UTSW 4 116,210,254 (GRCm39) missense probably benign 0.36
R4980:Mast2 UTSW 4 116,174,948 (GRCm39) missense probably damaging 1.00
R5322:Mast2 UTSW 4 116,190,608 (GRCm39) critical splice donor site probably null
R5462:Mast2 UTSW 4 116,164,655 (GRCm39) missense probably damaging 0.99
R5586:Mast2 UTSW 4 116,292,760 (GRCm39) missense probably damaging 0.99
R5750:Mast2 UTSW 4 116,166,086 (GRCm39) intron probably benign
R5771:Mast2 UTSW 4 116,190,622 (GRCm39) missense possibly damaging 0.60
R5885:Mast2 UTSW 4 116,172,035 (GRCm39) missense probably damaging 1.00
R6230:Mast2 UTSW 4 116,183,295 (GRCm39) missense probably damaging 1.00
R6347:Mast2 UTSW 4 116,174,929 (GRCm39) missense probably damaging 1.00
R6527:Mast2 UTSW 4 116,172,136 (GRCm39) missense probably damaging 0.99
R6619:Mast2 UTSW 4 116,173,694 (GRCm39) nonsense probably null
R7070:Mast2 UTSW 4 116,168,052 (GRCm39) missense probably benign 0.03
R7303:Mast2 UTSW 4 116,165,508 (GRCm39) missense possibly damaging 0.63
R7822:Mast2 UTSW 4 116,170,070 (GRCm39) missense probably damaging 1.00
R7843:Mast2 UTSW 4 116,210,208 (GRCm39) missense probably damaging 0.98
R7918:Mast2 UTSW 4 116,292,732 (GRCm39) missense possibly damaging 0.50
R7939:Mast2 UTSW 4 116,287,668 (GRCm39) missense probably benign 0.09
R8052:Mast2 UTSW 4 116,170,172 (GRCm39) missense probably damaging 0.99
R8115:Mast2 UTSW 4 116,292,644 (GRCm39) missense probably benign 0.01
R8312:Mast2 UTSW 4 116,287,683 (GRCm39) missense probably benign
R8398:Mast2 UTSW 4 116,165,946 (GRCm39) missense probably damaging 1.00
R8477:Mast2 UTSW 4 116,164,407 (GRCm39) missense probably benign 0.43
R8759:Mast2 UTSW 4 116,292,757 (GRCm39) missense possibly damaging 0.80
R8832:Mast2 UTSW 4 116,168,875 (GRCm39) critical splice donor site probably null
R9245:Mast2 UTSW 4 116,167,701 (GRCm39) missense probably damaging 1.00
R9261:Mast2 UTSW 4 116,165,900 (GRCm39) missense probably damaging 1.00
R9530:Mast2 UTSW 4 116,169,535 (GRCm39) missense probably damaging 1.00
R9642:Mast2 UTSW 4 116,170,966 (GRCm39) missense probably damaging 0.99
R9709:Mast2 UTSW 4 116,173,044 (GRCm39) missense probably damaging 1.00
R9745:Mast2 UTSW 4 116,167,815 (GRCm39) missense probably benign 0.00
R9752:Mast2 UTSW 4 116,179,508 (GRCm39) missense probably benign 0.06
X0003:Mast2 UTSW 4 116,164,844 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTAGCCCTAGCCCTTTGAG -3'
(R):5'- GAGGATGACACCAGCTACTTTG -3'

Sequencing Primer
(F):5'- GAGCTCCTTTTCTGAAAGAGGTCC -3'
(R):5'- CCAGCTACTTTGATAGTAAGGCC -3'
Posted On 2022-11-14