Incidental Mutation 'R9746:Trp73'
ID 732105
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Name transformation related protein 73
Synonyms deltaNp73, TAp73, p73
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.665) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 154140706-154224332 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 154165859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 118 (T118I)
Ref Sequence ENSEMBL: ENSMUSP00000101269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097762] [ENSMUST00000097763] [ENSMUST00000105643] [ENSMUST00000105644] [ENSMUST00000133533] [ENSMUST00000139634] [ENSMUST00000155642]
AlphaFold Q9JJP2
Predicted Effect possibly damaging
Transcript: ENSMUST00000097762
AA Change: T70I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026
AA Change: T70I

DomainStartEndE-ValueType
Pfam:P53 64 260 2.6e-111 PFAM
Pfam:P53_tetramer 296 337 8.5e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Pfam:SAM_2 352 406 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097763
AA Change: T70I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026
AA Change: T70I

DomainStartEndE-ValueType
Pfam:P53 64 260 6.4e-112 PFAM
Pfam:P53_tetramer 296 337 2.3e-21 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105643
AA Change: T70I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026
AA Change: T70I

DomainStartEndE-ValueType
Pfam:P53 64 260 2.1e-111 PFAM
Pfam:P53_tetramer 296 337 7.6e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105644
AA Change: T118I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026
AA Change: T118I

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133533
AA Change: T70I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026
AA Change: T70I

DomainStartEndE-ValueType
Pfam:P53 64 260 3.8e-111 PFAM
Pfam:P53_tetramer 296 337 1.1e-20 PFAM
low complexity region 342 350 N/A INTRINSIC
SAM 438 504 2.71e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139634
AA Change: T158I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114736
Gene: ENSMUSG00000029026
AA Change: T158I

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:P53 152 204 3.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155642
AA Change: T48I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026
AA Change: T48I

DomainStartEndE-ValueType
Pfam:P53 42 213 1.3e-94 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154,165,943 (GRCm39) missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154,148,885 (GRCm39) missense probably null 0.98
IGL02344:Trp73 APN 4 154,146,500 (GRCm39) missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154,146,963 (GRCm39) splice site probably null
IGL02956:Trp73 APN 4 154,148,920 (GRCm39) splice site probably benign
IGL03093:Trp73 APN 4 154,189,330 (GRCm39) missense probably benign 0.00
slowpoke UTSW 4 154,149,089 (GRCm39) splice site probably null
R0238:Trp73 UTSW 4 154,146,981 (GRCm39) unclassified probably benign
R0238:Trp73 UTSW 4 154,146,981 (GRCm39) unclassified probably benign
R0363:Trp73 UTSW 4 154,148,406 (GRCm39) missense probably benign 0.17
R0409:Trp73 UTSW 4 154,148,841 (GRCm39) missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154,165,780 (GRCm39) splice site probably null
R1531:Trp73 UTSW 4 154,148,352 (GRCm39) missense probably benign 0.31
R2002:Trp73 UTSW 4 154,165,902 (GRCm39) missense probably damaging 1.00
R2185:Trp73 UTSW 4 154,189,274 (GRCm39) critical splice donor site probably null
R3965:Trp73 UTSW 4 154,146,493 (GRCm39) missense probably benign 0.03
R3966:Trp73 UTSW 4 154,146,493 (GRCm39) missense probably benign 0.03
R4247:Trp73 UTSW 4 154,149,089 (GRCm39) splice site probably null
R4595:Trp73 UTSW 4 154,148,874 (GRCm39) missense probably damaging 0.99
R5170:Trp73 UTSW 4 154,189,295 (GRCm39) missense possibly damaging 0.95
R5260:Trp73 UTSW 4 154,147,059 (GRCm39) missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154,145,049 (GRCm39) missense possibly damaging 0.68
R6173:Trp73 UTSW 4 154,188,798 (GRCm39) missense probably damaging 1.00
R6252:Trp73 UTSW 4 154,148,854 (GRCm39) missense probably damaging 1.00
R6950:Trp73 UTSW 4 154,146,510 (GRCm39) missense probably benign 0.18
R7043:Trp73 UTSW 4 154,151,464 (GRCm39) splice site probably null
R7050:Trp73 UTSW 4 154,165,899 (GRCm39) missense probably damaging 1.00
R7052:Trp73 UTSW 4 154,149,140 (GRCm39) missense probably damaging 0.98
R7620:Trp73 UTSW 4 154,143,714 (GRCm39) nonsense probably null
R8086:Trp73 UTSW 4 154,201,052 (GRCm39) missense unknown
R9034:Trp73 UTSW 4 154,152,088 (GRCm39) missense probably benign 0.00
R9647:Trp73 UTSW 4 154,165,788 (GRCm39) missense probably damaging 1.00
R9671:Trp73 UTSW 4 154,148,403 (GRCm39) missense probably benign 0.03
Z1176:Trp73 UTSW 4 154,151,469 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTGTGTGCTCATTCAG -3'
(R):5'- GGCTCCTGTAACAAGACACC -3'

Sequencing Primer
(F):5'- CATTCAGTCCTCAGTACCAGG -3'
(R):5'- TGGGGCTTCCACCTTAGC -3'
Posted On 2022-11-14