Incidental Mutation 'R9746:Klhl7'
ID 732106
Institutional Source Beutler Lab
Gene Symbol Klhl7
Ensembl Gene ENSMUSG00000028986
Gene Name kelch-like 7
Synonyms SBBI26, Klhl6, 2700038B03Rik, D5Ertd363e
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.590) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 24305603-24365790 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 24331818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030841] [ENSMUST00000030841] [ENSMUST00000163409] [ENSMUST00000200116]
AlphaFold Q8BUL5
Predicted Effect probably null
Transcript: ENSMUST00000030841
SMART Domains Protein: ENSMUSP00000030841
Gene: ENSMUSG00000028986

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 7.49e-29 SMART
BACK 146 248 8.42e-36 SMART
Kelch 337 382 7.5e0 SMART
Kelch 383 430 1.97e-7 SMART
Kelch 431 481 2.25e-11 SMART
Kelch 482 528 4.4e-5 SMART
Blast:Kelch 529 576 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000030841
SMART Domains Protein: ENSMUSP00000030841
Gene: ENSMUSG00000028986

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 7.49e-29 SMART
BACK 146 248 8.42e-36 SMART
Kelch 337 382 7.5e0 SMART
Kelch 383 430 1.97e-7 SMART
Kelch 431 481 2.25e-11 SMART
Kelch 482 528 4.4e-5 SMART
Blast:Kelch 529 576 1e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163409
SMART Domains Protein: ENSMUSP00000129461
Gene: ENSMUSG00000028986

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 7.49e-29 SMART
BACK 146 248 8.42e-36 SMART
Kelch 337 382 7.5e0 SMART
Kelch 383 430 1.97e-7 SMART
Kelch 431 470 4.1e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200116
SMART Domains Protein: ENSMUSP00000143000
Gene: ENSMUSG00000028986

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 4.7e-31 SMART
BACK 146 248 6.3e-40 SMART
Pfam:Kelch_1 325 365 2.4e-4 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a BTB-Kelch-related protein. The encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Klhl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Klhl7 APN 5 24,346,279 (GRCm39) nonsense probably null
IGL03149:Klhl7 APN 5 24,364,687 (GRCm39) missense probably benign 0.02
R0433:Klhl7 UTSW 5 24,332,700 (GRCm39) missense probably damaging 0.98
R1301:Klhl7 UTSW 5 24,364,489 (GRCm39) missense probably damaging 1.00
R1521:Klhl7 UTSW 5 24,354,108 (GRCm39) splice site probably null
R2143:Klhl7 UTSW 5 24,305,861 (GRCm39) missense probably benign
R2144:Klhl7 UTSW 5 24,305,861 (GRCm39) missense probably benign
R2145:Klhl7 UTSW 5 24,305,861 (GRCm39) missense probably benign
R3409:Klhl7 UTSW 5 24,343,319 (GRCm39) missense probably damaging 0.96
R3410:Klhl7 UTSW 5 24,343,319 (GRCm39) missense probably damaging 0.96
R3411:Klhl7 UTSW 5 24,343,319 (GRCm39) missense probably damaging 0.96
R4927:Klhl7 UTSW 5 24,346,185 (GRCm39) missense possibly damaging 0.81
R5284:Klhl7 UTSW 5 24,364,615 (GRCm39) missense probably benign 0.01
R5316:Klhl7 UTSW 5 24,332,748 (GRCm39) missense probably benign 0.30
R5400:Klhl7 UTSW 5 24,331,918 (GRCm39) missense probably damaging 1.00
R6644:Klhl7 UTSW 5 24,354,244 (GRCm39) missense probably damaging 1.00
R7122:Klhl7 UTSW 5 24,343,433 (GRCm39) missense probably damaging 0.99
R7567:Klhl7 UTSW 5 24,331,844 (GRCm39) missense probably benign
R7658:Klhl7 UTSW 5 24,346,284 (GRCm39) missense probably benign 0.11
R8312:Klhl7 UTSW 5 24,339,965 (GRCm39) missense probably damaging 1.00
R8431:Klhl7 UTSW 5 24,343,473 (GRCm39) missense possibly damaging 0.82
R8827:Klhl7 UTSW 5 24,363,635 (GRCm39) critical splice donor site probably null
R9163:Klhl7 UTSW 5 24,364,465 (GRCm39) missense probably damaging 1.00
X0067:Klhl7 UTSW 5 24,346,293 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGCCTCAGAGTGATTCTC -3'
(R):5'- ACAGCTGACCACTCTCATTC -3'

Sequencing Primer
(F):5'- ATAATCTTGGCTGTCCTGGAATC -3'
(R):5'- CTCTTTACTGTCTTGTAGCCTTAAG -3'
Posted On 2022-11-14