Incidental Mutation 'R9746:Vmn2r13'
ID 732109
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Name vomeronasal 2, receptor 13
Synonyms Gm4867
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 109303889-109339973 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 109339773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
AlphaFold L7N1X2
Predicted Effect probably null
Transcript: ENSMUST00000053253
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109,303,964 (GRCm39) missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109,304,568 (GRCm39) missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109,322,085 (GRCm39) missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109,321,981 (GRCm39) missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109,339,883 (GRCm39) missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109,304,148 (GRCm39) missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109,319,645 (GRCm39) missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109,305,955 (GRCm39) missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109,304,398 (GRCm39) missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109,304,151 (GRCm39) missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109,304,332 (GRCm39) missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109,304,395 (GRCm39) missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109,321,679 (GRCm39) missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109,304,713 (GRCm39) missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109,322,068 (GRCm39) missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109,322,001 (GRCm39) missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109,306,040 (GRCm39) missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109,339,852 (GRCm39) missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109,339,943 (GRCm39) missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109,306,058 (GRCm39) missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109,306,058 (GRCm39) missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109,319,644 (GRCm39) missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109,322,178 (GRCm39) missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109,319,627 (GRCm39) missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109,304,721 (GRCm39) missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109,304,566 (GRCm39) missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109,304,322 (GRCm39) missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109,323,065 (GRCm39) missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109,304,331 (GRCm39) missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109,321,938 (GRCm39) missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109,321,841 (GRCm39) missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109,339,805 (GRCm39) missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109,321,580 (GRCm39) missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109,339,860 (GRCm39) missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109,321,846 (GRCm39) missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109,321,966 (GRCm39) missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109,322,167 (GRCm39) missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109,321,982 (GRCm39) missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109,323,085 (GRCm39) missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109,304,540 (GRCm39) nonsense probably null
R6486:Vmn2r13 UTSW 5 109,304,425 (GRCm39) missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109,304,806 (GRCm39) splice site probably null
R6700:Vmn2r13 UTSW 5 109,322,938 (GRCm39) missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109,306,015 (GRCm39) missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109,304,753 (GRCm39) nonsense probably null
R7276:Vmn2r13 UTSW 5 109,321,645 (GRCm39) missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109,339,909 (GRCm39) missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109,339,909 (GRCm39) missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109,319,557 (GRCm39) splice site probably null
R7607:Vmn2r13 UTSW 5 109,321,506 (GRCm39) missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109,319,618 (GRCm39) missense probably benign 0.00
R8116:Vmn2r13 UTSW 5 109,322,926 (GRCm39) missense probably benign 0.12
R8242:Vmn2r13 UTSW 5 109,322,872 (GRCm39) missense possibly damaging 0.65
R8294:Vmn2r13 UTSW 5 109,322,978 (GRCm39) missense probably benign 0.02
R8340:Vmn2r13 UTSW 5 109,322,006 (GRCm39) missense probably benign 0.00
R8692:Vmn2r13 UTSW 5 109,319,514 (GRCm39) missense probably benign 0.03
R8742:Vmn2r13 UTSW 5 109,304,263 (GRCm39) missense probably benign 0.02
R9022:Vmn2r13 UTSW 5 109,304,242 (GRCm39) missense possibly damaging 0.94
R9281:Vmn2r13 UTSW 5 109,303,953 (GRCm39) missense probably damaging 1.00
R9529:Vmn2r13 UTSW 5 109,304,064 (GRCm39) missense probably damaging 1.00
R9708:Vmn2r13 UTSW 5 109,322,007 (GRCm39) missense probably benign 0.00
X0066:Vmn2r13 UTSW 5 109,304,085 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACTGGAGTCCAATGTAGTAAAGC -3'
(R):5'- CTAGCAGATATGAAGGAGCTATGTG -3'

Sequencing Primer
(F):5'- AGCTAAACTGTGACACATTTGAC -3'
(R):5'- CAGATATGAAGGAGCTATGTGTTTTC -3'
Posted On 2022-11-14