Incidental Mutation 'R9746:Ap3b2'
ID 732121
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms beta3B, Naptb
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 81460399-81493925 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81476344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 373 (F373S)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably damaging
Transcript: ENSMUST00000082090
AA Change: F373S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: F373S

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000152355
AA Change: F373S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,031 H307L probably benign Het
Acnat1 A T 4: 49,450,652 L153H probably damaging Het
Actn4 A T 7: 28,919,006 D76E probably benign Het
Afdn A C 17: 13,846,520 M640L probably benign Het
Angpt1 A T 15: 42,676,441 F7L probably benign Het
Armc2 T A 10: 41,924,461 Y650F probably damaging Het
Atg2b G T 12: 105,663,938 T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 54,975,110 probably null Het
Capn8 G A 1: 182,611,105 probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cfap54 T C 10: 92,801,219 N3103D probably benign Het
Chd9 G A 8: 91,011,435 R1565Q unknown Het
Cir1 G A 2: 73,303,808 T139I probably damaging Het
Cmah T C 13: 24,435,690 probably null Het
Cnpy1 T C 5: 28,245,802 D2G probably damaging Het
Dennd4a A T 9: 64,894,511 T979S probably benign Het
Dnah11 T A 12: 117,878,576 K4423* probably null Het
Dnajb4 A G 3: 152,186,683 I171T possibly damaging Het
Dpm1 A T 2: 168,230,387 probably null Het
Dtwd1 A G 2: 126,154,675 T27A probably benign Het
Ep400 C T 5: 110,742,006 D464N unknown Het
Epb42 A T 2: 121,024,610 I498N probably benign Het
Fhod1 A G 8: 105,337,416 V219A unknown Het
Gabrb2 A T 11: 42,626,609 E419D probably benign Het
Galnt18 A T 7: 111,471,961 N615K possibly damaging Het
Gm13084 T C 4: 143,810,316 T482A probably benign Het
Gm29106 T A 1: 118,199,524 H315Q possibly damaging Het
Gprin2 G T 14: 34,195,658 Q52K probably benign Het
Grm4 A T 17: 27,438,791 Y414N probably damaging Het
Gulo C A 14: 65,988,181 probably null Het
H2-M1 A C 17: 36,670,105 V313G possibly damaging Het
Hectd3 T C 4: 116,995,754 W118R probably damaging Het
Hs6st3 G A 14: 119,869,080 C300Y probably damaging Het
Il1rl2 T A 1: 40,365,359 S547T possibly damaging Het
Kank1 G T 19: 25,409,508 V182F probably damaging Het
Kif20b T A 19: 34,950,749 L1137* probably null Het
Klhl7 A G 5: 24,126,820 probably null Het
Krt13 T A 11: 100,121,161 D112V possibly damaging Het
Ltbr A G 6: 125,313,101 V71A probably benign Het
Ly6g T C 15: 75,158,609 V92A probably benign Het
Map2k3 G A 11: 60,932,103 probably benign Het
Mast2 A C 4: 116,311,730 D842E probably benign Het
Mpo T G 11: 87,803,523 M693R probably benign Het
Myo15 C A 11: 60,487,408 S212* probably null Het
Nadk2 C T 15: 9,106,736 R37* probably null Het
Ncapd3 G A 9: 27,063,359 R709H probably benign Het
Nck2 T A 1: 43,533,732 Y55* probably null Het
Neurl4 A G 11: 69,907,475 D777G probably damaging Het
Npr2 G A 4: 43,633,527 V224M possibly damaging Het
Nptx2 T A 5: 144,548,140 S148T probably benign Het
Nr1d1 T C 11: 98,770,334 T369A probably benign Het
Nub1 T G 5: 24,703,485 F411V probably damaging Het
Nup188 T A 2: 30,304,288 Y158N probably damaging Het
Olfr1031 A G 2: 85,992,747 Y310C probably benign Het
Olfr513 A G 7: 108,755,432 N192S probably benign Het
Olfr716 A T 7: 107,147,453 I46F probably benign Het
Olfr804 A T 10: 129,705,339 I154F probably damaging Het
Olfr897-ps1 T A 9: 38,309,632 I279K unknown Het
Orc2 C T 1: 58,497,451 G85S probably damaging Het
Pak1ip1 T A 13: 41,009,267 V182D probably damaging Het
Parvg T G 15: 84,326,223 C30W probably benign Het
Pcdha1 T A 18: 36,932,660 D792E probably benign Het
Ppp1r13b G T 12: 111,833,808 Q635K probably benign Het
Psg16 A G 7: 17,098,161 I341V probably benign Het
Psme4 C T 11: 30,876,868 Q1796* probably null Het
Ptn T G 6: 36,715,764 probably null Het
Rapsn C T 2: 91,045,478 P400L probably damaging Het
Rasal1 G A 5: 120,662,293 G207D probably damaging Het
Rdx A G 9: 52,063,578 I5V probably benign Het
Rpf1 A G 3: 146,517,778 I105T probably damaging Het
Rps15a A T 7: 118,109,997 F79I possibly damaging Het
Rwdd2b G A 16: 87,436,753 P153L probably benign Het
Scaf11 G A 15: 96,420,417 S422L probably damaging Het
Serpinb3b T A 1: 107,154,673 E287V possibly damaging Het
Sgta T C 10: 81,051,284 D49G possibly damaging Het
Sin3a T A 9: 57,118,074 M1068K probably benign Het
Slc12a9 G A 5: 137,321,409 R615W probably damaging Het
Slc26a3 T A 12: 31,449,146 S151T probably benign Het
Slc4a8 C A 15: 100,783,840 H111N probably damaging Het
Syngr1 G A 15: 80,091,458 R22K probably benign Het
Tars2 A T 3: 95,754,765 V25E probably benign Het
Tbx15 A G 3: 99,352,331 Y506C probably damaging Het
Tgm4 A T 9: 123,046,569 K162N possibly damaging Het
Tmem253 A G 14: 52,017,982 E83G probably damaging Het
Trp73 G A 4: 154,081,402 T118I probably damaging Het
Trpm7 A G 2: 126,822,658 S934P possibly damaging Het
Ttc23l G A 15: 10,523,643 S330L probably benign Het
Tub A C 7: 109,025,638 D199A probably benign Het
Uri1 A C 7: 37,996,685 probably null Het
Usp16 C T 16: 87,479,232 A486V probably benign Het
Vmn1r12 A G 6: 57,159,541 I208V probably benign Het
Vmn2r116 A T 17: 23,401,823 M844L probably benign Het
Vmn2r13 C T 5: 109,191,907 probably null Het
Xpnpep1 T C 19: 53,013,461 D118G probably damaging Het
Zfp111 G A 7: 24,198,642 P516S possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
R8325:Ap3b2 UTSW 7 81484489 splice site probably null
R8355:Ap3b2 UTSW 7 81473103 missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81473035 missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81477153 missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81477183 missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81467444 missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81463798 missense unknown
R9304:Ap3b2 UTSW 7 81463271 missense unknown
R9321:Ap3b2 UTSW 7 81464504 critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81478009 missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81473903 missense probably benign 0.16
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATCATAACAGGGTAGGCTTCACAAAG -3'
(R):5'- TAGATCCTGAAGGGGCCATG -3'

Sequencing Primer
(F):5'- TTCACAAAGAGGCAGGCAC -3'
(R):5'- CTGAAGGGGCCATGGTGGG -3'
Posted On 2022-11-14