Incidental Mutation 'R9746:Chd9'
ID 732127
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Name chromodomain helicase DNA binding protein 9
Synonyms AD013, 1810014J18Rik, 9030205D12Rik, A330063D19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 91554980-91781144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 91738063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1565 (R1565Q)
Ref Sequence ENSEMBL: ENSMUSP00000046356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: R1565Q
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: R1565Q

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: R1565Q
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: R1565Q

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209203
AA Change: R1565Q

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: R1565Q
Predicted Effect probably benign
Transcript: ENSMUST00000210947
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91,752,020 (GRCm39) missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91,732,426 (GRCm39) missense probably damaging 1.00
IGL00589:Chd9 APN 8 91,742,474 (GRCm39) missense probably damaging 1.00
IGL00640:Chd9 APN 8 91,712,760 (GRCm39) missense probably damaging 0.99
IGL00663:Chd9 APN 8 91,710,118 (GRCm39) missense probably damaging 1.00
IGL00852:Chd9 APN 8 91,699,835 (GRCm39) missense probably benign 0.29
IGL00908:Chd9 APN 8 91,723,508 (GRCm39) missense probably damaging 1.00
IGL00911:Chd9 APN 8 91,778,320 (GRCm39) missense probably damaging 1.00
IGL01068:Chd9 APN 8 91,768,744 (GRCm39) missense probably benign 0.13
IGL01668:Chd9 APN 8 91,753,404 (GRCm39) missense possibly damaging 0.53
IGL01873:Chd9 APN 8 91,660,395 (GRCm39) missense probably benign 0.00
IGL01969:Chd9 APN 8 91,760,138 (GRCm39) missense possibly damaging 0.72
IGL02105:Chd9 APN 8 91,659,116 (GRCm39) missense probably damaging 1.00
IGL02153:Chd9 APN 8 91,683,122 (GRCm39) nonsense probably null
IGL02164:Chd9 APN 8 91,659,849 (GRCm39) missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91,778,312 (GRCm39) missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91,760,210 (GRCm39) missense probably benign 0.33
IGL02892:Chd9 APN 8 91,703,543 (GRCm39) splice site probably benign
IGL02897:Chd9 APN 8 91,660,496 (GRCm39) splice site probably benign
IGL03005:Chd9 APN 8 91,738,075 (GRCm39) missense probably damaging 0.98
IGL03062:Chd9 APN 8 91,741,895 (GRCm39) splice site probably benign
IGL03140:Chd9 APN 8 91,768,856 (GRCm39) missense possibly damaging 0.91
hovel UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
shack UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R0056:Chd9 UTSW 8 91,660,165 (GRCm39) missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91,735,464 (GRCm39) splice site probably null
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0432:Chd9 UTSW 8 91,721,078 (GRCm39) splice site probably benign
R0454:Chd9 UTSW 8 91,699,859 (GRCm39) missense possibly damaging 0.83
R0573:Chd9 UTSW 8 91,725,223 (GRCm39) missense probably damaging 1.00
R0580:Chd9 UTSW 8 91,721,191 (GRCm39) missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91,763,170 (GRCm39) missense possibly damaging 0.82
R0662:Chd9 UTSW 8 91,704,304 (GRCm39) missense probably damaging 0.99
R0825:Chd9 UTSW 8 91,777,825 (GRCm39) missense probably benign 0.06
R0945:Chd9 UTSW 8 91,659,630 (GRCm39) missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
R0967:Chd9 UTSW 8 91,716,107 (GRCm39) missense probably damaging 1.00
R1015:Chd9 UTSW 8 91,659,206 (GRCm39) missense probably damaging 0.99
R1066:Chd9 UTSW 8 91,712,764 (GRCm39) nonsense probably null
R1244:Chd9 UTSW 8 91,749,557 (GRCm39) missense probably damaging 0.99
R1505:Chd9 UTSW 8 91,733,123 (GRCm39) splice site probably null
R1570:Chd9 UTSW 8 91,763,170 (GRCm39) missense probably benign 0.03
R1591:Chd9 UTSW 8 91,710,166 (GRCm39) missense probably damaging 0.97
R1624:Chd9 UTSW 8 91,725,163 (GRCm39) missense probably benign 0.17
R1626:Chd9 UTSW 8 91,721,224 (GRCm39) missense probably benign 0.00
R1632:Chd9 UTSW 8 91,683,335 (GRCm39) nonsense probably null
R1649:Chd9 UTSW 8 91,659,229 (GRCm39) missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91,749,418 (GRCm39) splice site probably null
R1668:Chd9 UTSW 8 91,767,814 (GRCm39) missense probably damaging 0.99
R1681:Chd9 UTSW 8 91,699,763 (GRCm39) missense probably damaging 0.98
R1695:Chd9 UTSW 8 91,728,410 (GRCm39) missense probably damaging 1.00
R1714:Chd9 UTSW 8 91,760,853 (GRCm39) utr 3 prime probably benign
R1746:Chd9 UTSW 8 91,737,326 (GRCm39) missense probably benign 0.01
R1843:Chd9 UTSW 8 91,737,422 (GRCm39) missense probably benign 0.19
R1844:Chd9 UTSW 8 91,683,323 (GRCm39) nonsense probably null
R1941:Chd9 UTSW 8 91,703,697 (GRCm39) critical splice donor site probably null
R2022:Chd9 UTSW 8 91,761,682 (GRCm39) missense probably benign 0.17
R2027:Chd9 UTSW 8 91,634,619 (GRCm39) unclassified probably benign
R2098:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2099:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2100:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2101:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2224:Chd9 UTSW 8 91,737,913 (GRCm39) missense probably benign 0.04
R2276:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2278:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2316:Chd9 UTSW 8 91,777,756 (GRCm39) missense probably damaging 0.99
R2507:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2508:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2988:Chd9 UTSW 8 91,757,088 (GRCm39) splice site probably null
R3418:Chd9 UTSW 8 91,763,219 (GRCm39) missense probably damaging 1.00
R3817:Chd9 UTSW 8 91,710,893 (GRCm39) splice site probably benign
R3923:Chd9 UTSW 8 91,660,147 (GRCm39) missense probably benign 0.16
R4001:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4003:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4006:Chd9 UTSW 8 91,660,188 (GRCm39) missense probably benign 0.12
R4013:Chd9 UTSW 8 91,699,797 (GRCm39) missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91,750,202 (GRCm39) missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91,737,304 (GRCm39) missense probably benign 0.04
R4125:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4126:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4452:Chd9 UTSW 8 91,704,308 (GRCm39) missense probably damaging 0.99
R4463:Chd9 UTSW 8 91,705,627 (GRCm39) missense probably benign 0.01
R4478:Chd9 UTSW 8 91,760,659 (GRCm39) utr 3 prime probably benign
R4587:Chd9 UTSW 8 91,763,134 (GRCm39) missense possibly damaging 0.95
R4628:Chd9 UTSW 8 91,710,091 (GRCm39) missense probably benign 0.05
R4667:Chd9 UTSW 8 91,760,428 (GRCm39) missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91,741,877 (GRCm39) missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91,760,858 (GRCm39) missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91,760,336 (GRCm39) missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91,733,254 (GRCm39) nonsense probably null
R5083:Chd9 UTSW 8 91,711,002 (GRCm39) missense probably damaging 1.00
R5088:Chd9 UTSW 8 91,704,147 (GRCm39) missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91,753,462 (GRCm39) nonsense probably null
R5307:Chd9 UTSW 8 91,723,777 (GRCm39) missense probably damaging 1.00
R5541:Chd9 UTSW 8 91,778,132 (GRCm39) missense probably benign 0.09
R5559:Chd9 UTSW 8 91,742,553 (GRCm39) critical splice donor site probably null
R5638:Chd9 UTSW 8 91,738,078 (GRCm39) missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91,763,190 (GRCm39) missense probably damaging 1.00
R5793:Chd9 UTSW 8 91,728,384 (GRCm39) missense probably damaging 1.00
R5827:Chd9 UTSW 8 91,716,078 (GRCm39) missense probably damaging 1.00
R5834:Chd9 UTSW 8 91,723,792 (GRCm39) missense probably damaging 1.00
R5875:Chd9 UTSW 8 91,778,464 (GRCm39) missense probably damaging 0.99
R6002:Chd9 UTSW 8 91,705,515 (GRCm39) missense probably damaging 1.00
R6091:Chd9 UTSW 8 91,761,691 (GRCm39) missense probably damaging 1.00
R6185:Chd9 UTSW 8 91,775,765 (GRCm39) missense probably damaging 1.00
R6246:Chd9 UTSW 8 91,659,045 (GRCm39) missense probably damaging 1.00
R6292:Chd9 UTSW 8 91,659,550 (GRCm39) missense probably benign 0.05
R6305:Chd9 UTSW 8 91,757,174 (GRCm39) missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91,737,903 (GRCm39) missense possibly damaging 0.95
R6438:Chd9 UTSW 8 91,725,149 (GRCm39) missense probably benign 0.02
R6470:Chd9 UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R6798:Chd9 UTSW 8 91,778,182 (GRCm39) missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91,769,579 (GRCm39) missense probably damaging 1.00
R6908:Chd9 UTSW 8 91,683,044 (GRCm39) missense probably benign 0.02
R6929:Chd9 UTSW 8 91,769,573 (GRCm39) missense probably damaging 1.00
R6969:Chd9 UTSW 8 91,705,542 (GRCm39) missense probably benign 0.34
R7043:Chd9 UTSW 8 91,760,843 (GRCm39) utr 3 prime probably benign
R7094:Chd9 UTSW 8 91,716,189 (GRCm39) missense unknown
R7126:Chd9 UTSW 8 91,741,853 (GRCm39) missense unknown
R7182:Chd9 UTSW 8 91,733,250 (GRCm39) missense unknown
R7219:Chd9 UTSW 8 91,728,394 (GRCm39) missense unknown
R7260:Chd9 UTSW 8 91,721,171 (GRCm39) missense unknown
R7293:Chd9 UTSW 8 91,760,707 (GRCm39) missense unknown
R7303:Chd9 UTSW 8 91,778,532 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,760,846 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,710,115 (GRCm39) missense unknown
R7451:Chd9 UTSW 8 91,760,446 (GRCm39) missense probably benign 0.27
R7451:Chd9 UTSW 8 91,760,418 (GRCm39) frame shift probably null
R7456:Chd9 UTSW 8 91,659,153 (GRCm39) nonsense probably null
R7481:Chd9 UTSW 8 91,683,066 (GRCm39) missense unknown
R7532:Chd9 UTSW 8 91,721,193 (GRCm39) missense unknown
R7570:Chd9 UTSW 8 91,721,208 (GRCm39) missense unknown
R7611:Chd9 UTSW 8 91,763,017 (GRCm39) missense probably damaging 1.00
R7673:Chd9 UTSW 8 91,778,325 (GRCm39) missense probably damaging 0.96
R7723:Chd9 UTSW 8 91,741,837 (GRCm39) missense unknown
R7739:Chd9 UTSW 8 91,761,653 (GRCm39) missense probably damaging 1.00
R7759:Chd9 UTSW 8 91,704,178 (GRCm39) critical splice donor site probably null
R7916:Chd9 UTSW 8 91,761,684 (GRCm39) nonsense probably null
R7921:Chd9 UTSW 8 91,768,909 (GRCm39) critical splice donor site probably null
R7957:Chd9 UTSW 8 91,778,326 (GRCm39) missense probably damaging 0.99
R7972:Chd9 UTSW 8 91,732,395 (GRCm39) missense unknown
R8108:Chd9 UTSW 8 91,659,852 (GRCm39) missense unknown
R8115:Chd9 UTSW 8 91,762,960 (GRCm39) missense probably damaging 0.99
R8165:Chd9 UTSW 8 91,767,769 (GRCm39) missense probably damaging 1.00
R8171:Chd9 UTSW 8 91,752,015 (GRCm39) missense possibly damaging 0.92
R8186:Chd9 UTSW 8 91,725,233 (GRCm39) missense unknown
R8208:Chd9 UTSW 8 91,763,891 (GRCm39) splice site probably null
R8256:Chd9 UTSW 8 91,660,129 (GRCm39) missense unknown
R8281:Chd9 UTSW 8 91,763,225 (GRCm39) missense probably damaging 1.00
R8504:Chd9 UTSW 8 91,723,472 (GRCm39) missense unknown
R8836:Chd9 UTSW 8 91,767,812 (GRCm39) missense probably damaging 0.99
R8892:Chd9 UTSW 8 91,660,468 (GRCm39) missense unknown
R8985:Chd9 UTSW 8 91,721,101 (GRCm39) missense unknown
R9029:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9030:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9038:Chd9 UTSW 8 91,716,233 (GRCm39) missense unknown
R9081:Chd9 UTSW 8 91,704,144 (GRCm39) nonsense probably null
R9134:Chd9 UTSW 8 91,659,754 (GRCm39) missense unknown
R9205:Chd9 UTSW 8 91,757,270 (GRCm39) missense probably benign 0.01
R9309:Chd9 UTSW 8 91,733,319 (GRCm39) missense unknown
R9375:Chd9 UTSW 8 91,725,335 (GRCm39) critical splice donor site probably null
R9449:Chd9 UTSW 8 91,659,174 (GRCm39) missense unknown
R9547:Chd9 UTSW 8 91,683,186 (GRCm39) missense unknown
R9573:Chd9 UTSW 8 91,704,302 (GRCm39) missense unknown
R9576:Chd9 UTSW 8 91,659,294 (GRCm39) missense unknown
R9601:Chd9 UTSW 8 91,732,360 (GRCm39) nonsense probably null
R9613:Chd9 UTSW 8 91,683,150 (GRCm39) nonsense probably null
R9639:Chd9 UTSW 8 91,760,840 (GRCm39) missense probably null
R9718:Chd9 UTSW 8 91,712,801 (GRCm39) missense unknown
R9762:Chd9 UTSW 8 91,712,741 (GRCm39) missense unknown
R9764:Chd9 UTSW 8 91,721,220 (GRCm39) missense unknown
R9790:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
R9791:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
RF007:Chd9 UTSW 8 91,760,578 (GRCm39) missense possibly damaging 0.66
X0065:Chd9 UTSW 8 91,763,200 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTCCCTTTTCACCAGG -3'
(R):5'- TAATATAAGCGCGTGTACCCACC -3'

Sequencing Primer
(F):5'- TCCCTTTTCACCAGGTGGGG -3'
(R):5'- GCGTGTACCCACCCACCC -3'
Posted On 2022-11-14