Mutagenetix > Incidental Mutation

Incidental Mutation 'R9746:Chd9'

732127

Institutional Source

Beutler Lab

Gene Symbol

Chd9

Ensembl Gene

ENSMUSG00000056608

Gene Name

chromodomain helicase DNA binding protein 9

Synonyms

1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9746 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90828352-91054516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 91011435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1565 (R1565Q)

Ref Sequence

ENSEMBL: ENSMUSP00000046356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000048665
AA Change: R1565Q

SMART Domains

Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: R1565Q

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2456	2505	6.77e-25	SMART
BRK	2530	2574	1.5e-17	SMART
low complexity region	2594	2608	N/A	INTRINSIC
low complexity region	2609	2639	N/A	INTRINSIC
low complexity region	2642	2659	N/A	INTRINSIC
low complexity region	2690	2704	N/A	INTRINSIC
low complexity region	2746	2771	N/A	INTRINSIC
low complexity region	2802	2813	N/A	INTRINSIC
low complexity region	2843	2869	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000109614
AA Change: R1565Q

SMART Domains

Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: R1565Q

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2472	2521	6.77e-25	SMART
BRK	2546	2590	1.5e-17	SMART
low complexity region	2610	2624	N/A	INTRINSIC
low complexity region	2625	2655	N/A	INTRINSIC
low complexity region	2658	2675	N/A	INTRINSIC
low complexity region	2706	2720	N/A	INTRINSIC
low complexity region	2762	2787	N/A	INTRINSIC
low complexity region	2818	2829	N/A	INTRINSIC
low complexity region	2859	2885	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209203
AA Change: R1565Q

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

unknown
Transcript: ENSMUST00000209423
AA Change: R1565Q

Predicted Effect

probably benign
Transcript: ENSMUST00000210947

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	T	A	1: 173,332,031	H307L	probably benign	Het
Acnat1	A	T	4: 49,450,652	L153H	probably damaging	Het
Actn4	A	T	7: 28,919,006	D76E	probably benign	Het
Afdn	A	C	17: 13,846,520	M640L	probably benign	Het
Angpt1	A	T	15: 42,676,441	F7L	probably benign	Het
Ap3b2	A	G	7: 81,476,344	F373S	probably damaging	Het
Armc2	T	A	10: 41,924,461	Y650F	probably damaging	Het
Atg2b	G	T	12: 105,663,938	T398K	possibly damaging	Het
Baz1a	CCATT	CCATTCATT	12: 54,975,110		probably null	Het
Capn8	G	A	1: 182,611,105		probably null	Het
Cdr1	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	X: 61,184,524		probably benign	Het
Cfap54	T	C	10: 92,801,219	N3103D	probably benign	Het
Cir1	G	A	2: 73,303,808	T139I	probably damaging	Het
Cmah	T	C	13: 24,435,690		probably null	Het
Cnpy1	T	C	5: 28,245,802	D2G	probably damaging	Het
Dennd4a	A	T	9: 64,894,511	T979S	probably benign	Het
Dnah11	T	A	12: 117,878,576	K4423*	probably null	Het
Dnajb4	A	G	3: 152,186,683	I171T	possibly damaging	Het
Dpm1	A	T	2: 168,230,387		probably null	Het
Dtwd1	A	G	2: 126,154,675	T27A	probably benign	Het
Ep400	C	T	5: 110,742,006	D464N	unknown	Het
Epb42	A	T	2: 121,024,610	I498N	probably benign	Het
Fhod1	A	G	8: 105,337,416	V219A	unknown	Het
Gabrb2	A	T	11: 42,626,609	E419D	probably benign	Het
Galnt18	A	T	7: 111,471,961	N615K	possibly damaging	Het
Gm13084	T	C	4: 143,810,316	T482A	probably benign	Het
Gm29106	T	A	1: 118,199,524	H315Q	possibly damaging	Het
Gprin2	G	T	14: 34,195,658	Q52K	probably benign	Het
Grm4	A	T	17: 27,438,791	Y414N	probably damaging	Het
Gulo	C	A	14: 65,988,181		probably null	Het
H2-M1	A	C	17: 36,670,105	V313G	possibly damaging	Het
Hectd3	T	C	4: 116,995,754	W118R	probably damaging	Het
Hs6st3	G	A	14: 119,869,080	C300Y	probably damaging	Het
Il1rl2	T	A	1: 40,365,359	S547T	possibly damaging	Het
Kank1	G	T	19: 25,409,508	V182F	probably damaging	Het
Kif20b	T	A	19: 34,950,749	L1137*	probably null	Het
Klhl7	A	G	5: 24,126,820		probably null	Het
Krt13	T	A	11: 100,121,161	D112V	possibly damaging	Het
Ltbr	A	G	6: 125,313,101	V71A	probably benign	Het
Ly6g	T	C	15: 75,158,609	V92A	probably benign	Het
Map2k3	G	A	11: 60,932,103		probably benign	Het
Mast2	A	C	4: 116,311,730	D842E	probably benign	Het
Mpo	T	G	11: 87,803,523	M693R	probably benign	Het
Myo15	C	A	11: 60,487,408	S212*	probably null	Het
Nadk2	C	T	15: 9,106,736	R37*	probably null	Het
Ncapd3	G	A	9: 27,063,359	R709H	probably benign	Het
Nck2	T	A	1: 43,533,732	Y55*	probably null	Het
Neurl4	A	G	11: 69,907,475	D777G	probably damaging	Het
Npr2	G	A	4: 43,633,527	V224M	possibly damaging	Het
Nptx2	T	A	5: 144,548,140	S148T	probably benign	Het
Nr1d1	T	C	11: 98,770,334	T369A	probably benign	Het
Nub1	T	G	5: 24,703,485	F411V	probably damaging	Het
Nup188	T	A	2: 30,304,288	Y158N	probably damaging	Het
Olfr1031	A	G	2: 85,992,747	Y310C	probably benign	Het
Olfr513	A	G	7: 108,755,432	N192S	probably benign	Het
Olfr716	A	T	7: 107,147,453	I46F	probably benign	Het
Olfr804	A	T	10: 129,705,339	I154F	probably damaging	Het
Olfr897-ps1	T	A	9: 38,309,632	I279K	unknown	Het
Orc2	C	T	1: 58,497,451	G85S	probably damaging	Het
Pak1ip1	T	A	13: 41,009,267	V182D	probably damaging	Het
Parvg	T	G	15: 84,326,223	C30W	probably benign	Het
Pcdha1	T	A	18: 36,932,660	D792E	probably benign	Het
Ppp1r13b	G	T	12: 111,833,808	Q635K	probably benign	Het
Psg16	A	G	7: 17,098,161	I341V	probably benign	Het
Psme4	C	T	11: 30,876,868	Q1796*	probably null	Het
Ptn	T	G	6: 36,715,764		probably null	Het
Rapsn	C	T	2: 91,045,478	P400L	probably damaging	Het
Rasal1	G	A	5: 120,662,293	G207D	probably damaging	Het
Rdx	A	G	9: 52,063,578	I5V	probably benign	Het
Rpf1	A	G	3: 146,517,778	I105T	probably damaging	Het
Rps15a	A	T	7: 118,109,997	F79I	possibly damaging	Het
Rwdd2b	G	A	16: 87,436,753	P153L	probably benign	Het
Scaf11	G	A	15: 96,420,417	S422L	probably damaging	Het
Serpinb3b	T	A	1: 107,154,673	E287V	possibly damaging	Het
Sgta	T	C	10: 81,051,284	D49G	possibly damaging	Het
Sin3a	T	A	9: 57,118,074	M1068K	probably benign	Het
Slc12a9	G	A	5: 137,321,409	R615W	probably damaging	Het
Slc26a3	T	A	12: 31,449,146	S151T	probably benign	Het
Slc4a8	C	A	15: 100,783,840	H111N	probably damaging	Het
Syngr1	G	A	15: 80,091,458	R22K	probably benign	Het
Tars2	A	T	3: 95,754,765	V25E	probably benign	Het
Tbx15	A	G	3: 99,352,331	Y506C	probably damaging	Het
Tgm4	A	T	9: 123,046,569	K162N	possibly damaging	Het
Tmem253	A	G	14: 52,017,982	E83G	probably damaging	Het
Trp73	G	A	4: 154,081,402	T118I	probably damaging	Het
Trpm7	A	G	2: 126,822,658	S934P	possibly damaging	Het
Ttc23l	G	A	15: 10,523,643	S330L	probably benign	Het
Tub	A	C	7: 109,025,638	D199A	probably benign	Het
Uri1	A	C	7: 37,996,685		probably null	Het
Usp16	C	T	16: 87,479,232	A486V	probably benign	Het
Vmn1r12	A	G	6: 57,159,541	I208V	probably benign	Het
Vmn2r116	A	T	17: 23,401,823	M844L	probably benign	Het
Vmn2r13	C	T	5: 109,191,907		probably null	Het
Xpnpep1	T	C	19: 53,013,461	D118G	probably damaging	Het
Zfp111	G	A	7: 24,198,642	P516S	possibly damaging	Het

Other mutations in Chd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Chd9	APN	8	91025392	missense	possibly damaging	0.79
IGL00547:Chd9	APN	8	91005798	missense	probably damaging	1.00
IGL00589:Chd9	APN	8	91015846	missense	probably damaging	1.00
IGL00640:Chd9	APN	8	90986132	missense	probably damaging	0.99
IGL00663:Chd9	APN	8	90983490	missense	probably damaging	1.00
IGL00852:Chd9	APN	8	90973207	missense	probably benign	0.29
IGL00908:Chd9	APN	8	90996880	missense	probably damaging	1.00
IGL00911:Chd9	APN	8	91051692	missense	probably damaging	1.00
IGL01068:Chd9	APN	8	91042116	missense	probably benign	0.13
IGL01668:Chd9	APN	8	91026776	missense	possibly damaging	0.53
IGL01873:Chd9	APN	8	90933767	missense	probably benign	0.00
IGL01969:Chd9	APN	8	91033510	missense	possibly damaging	0.72
IGL02105:Chd9	APN	8	90932488	missense	probably damaging	1.00
IGL02153:Chd9	APN	8	90956494	nonsense	probably null
IGL02164:Chd9	APN	8	90933221	missense	possibly damaging	0.94
IGL02725:Chd9	APN	8	91051684	missense	possibly damaging	0.78
IGL02755:Chd9	APN	8	91033582	missense	probably benign	0.33
IGL02892:Chd9	APN	8	90976915	splice site	probably benign
IGL02897:Chd9	APN	8	90933868	splice site	probably benign
IGL03005:Chd9	APN	8	91011447	missense	probably damaging	0.98
IGL03062:Chd9	APN	8	91015267	splice site	probably benign
IGL03140:Chd9	APN	8	91042228	missense	possibly damaging	0.91
hovel	UTSW	8	91015204	missense	probably benign	0.19
shack	UTSW	8	90932798	missense	probably damaging	1.00
R0056:Chd9	UTSW	8	90933537	missense	possibly damaging	0.62
R0157:Chd9	UTSW	8	91008836	splice site	probably null
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0432:Chd9	UTSW	8	90994450	splice site	probably benign
R0454:Chd9	UTSW	8	90973231	missense	possibly damaging	0.83
R0573:Chd9	UTSW	8	90998595	missense	probably damaging	1.00
R0580:Chd9	UTSW	8	90994563	missense	possibly damaging	0.91
R0604:Chd9	UTSW	8	91036542	missense	possibly damaging	0.82
R0662:Chd9	UTSW	8	90977676	missense	probably damaging	0.99
R0825:Chd9	UTSW	8	91051197	missense	probably benign	0.06
R0945:Chd9	UTSW	8	90933002	missense	possibly damaging	0.60
R0964:Chd9	UTSW	8	91015204	missense	probably benign	0.19
R0967:Chd9	UTSW	8	90989479	missense	probably damaging	1.00
R1015:Chd9	UTSW	8	90932578	missense	probably damaging	0.99
R1066:Chd9	UTSW	8	90986136	nonsense	probably null
R1244:Chd9	UTSW	8	91022929	missense	probably damaging	0.99
R1505:Chd9	UTSW	8	91006495	splice site	probably null
R1570:Chd9	UTSW	8	91036542	missense	probably benign	0.03
R1591:Chd9	UTSW	8	90983538	missense	probably damaging	0.97
R1624:Chd9	UTSW	8	90998535	missense	probably benign	0.17
R1626:Chd9	UTSW	8	90994596	missense	probably benign	0.00
R1632:Chd9	UTSW	8	90956707	nonsense	probably null
R1649:Chd9	UTSW	8	90932601	missense	possibly damaging	0.88
R1664:Chd9	UTSW	8	91022790	splice site	probably null
R1668:Chd9	UTSW	8	91041186	missense	probably damaging	0.99
R1681:Chd9	UTSW	8	90973135	missense	probably damaging	0.98
R1695:Chd9	UTSW	8	91001782	missense	probably damaging	1.00
R1714:Chd9	UTSW	8	91034225	utr 3 prime	probably benign
R1746:Chd9	UTSW	8	91010698	missense	probably benign	0.01
R1843:Chd9	UTSW	8	91010794	missense	probably benign	0.19
R1844:Chd9	UTSW	8	90956695	nonsense	probably null
R1941:Chd9	UTSW	8	90977069	critical splice donor site	probably null
R2022:Chd9	UTSW	8	91035054	missense	probably benign	0.17
R2027:Chd9	UTSW	8	90907991	unclassified	probably benign
R2098:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2099:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2100:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2101:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2224:Chd9	UTSW	8	91011285	missense	probably benign	0.04
R2276:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2278:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2316:Chd9	UTSW	8	91051128	missense	probably damaging	0.99
R2507:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2508:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2988:Chd9	UTSW	8	91030460	splice site	probably null
R3418:Chd9	UTSW	8	91036591	missense	probably damaging	1.00
R3817:Chd9	UTSW	8	90984265	splice site	probably benign
R3923:Chd9	UTSW	8	90933519	missense	probably benign	0.16
R4001:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4003:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4006:Chd9	UTSW	8	90933560	missense	probably benign	0.12
R4013:Chd9	UTSW	8	90973169	missense	possibly damaging	0.82
R4067:Chd9	UTSW	8	91023574	missense	possibly damaging	0.53
R4108:Chd9	UTSW	8	91010676	missense	probably benign	0.04
R4125:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4126:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4452:Chd9	UTSW	8	90977680	missense	probably damaging	0.99
R4463:Chd9	UTSW	8	90978999	missense	probably benign	0.01
R4478:Chd9	UTSW	8	91034031	utr 3 prime	probably benign
R4587:Chd9	UTSW	8	91036506	missense	possibly damaging	0.95
R4628:Chd9	UTSW	8	90983463	missense	probably benign	0.05
R4667:Chd9	UTSW	8	91033800	missense	possibly damaging	0.73
R4908:Chd9	UTSW	8	91015249	missense	possibly damaging	0.50
R4912:Chd9	UTSW	8	91034230	missense	possibly damaging	0.84
R4977:Chd9	UTSW	8	91033708	missense	possibly damaging	0.96
R5016:Chd9	UTSW	8	91006626	nonsense	probably null
R5083:Chd9	UTSW	8	90984374	missense	probably damaging	1.00
R5088:Chd9	UTSW	8	90977519	missense	possibly damaging	0.94
R5090:Chd9	UTSW	8	91026834	nonsense	probably null
R5307:Chd9	UTSW	8	90997149	missense	probably damaging	1.00
R5541:Chd9	UTSW	8	91051504	missense	probably benign	0.09
R5559:Chd9	UTSW	8	91015925	critical splice donor site	probably null
R5638:Chd9	UTSW	8	91011450	missense	possibly damaging	0.67
R5640:Chd9	UTSW	8	91036562	missense	probably damaging	1.00
R5793:Chd9	UTSW	8	91001756	missense	probably damaging	1.00
R5827:Chd9	UTSW	8	90989450	missense	probably damaging	1.00
R5834:Chd9	UTSW	8	90997164	missense	probably damaging	1.00
R5875:Chd9	UTSW	8	91051836	missense	probably damaging	0.99
R6002:Chd9	UTSW	8	90978887	missense	probably damaging	1.00
R6091:Chd9	UTSW	8	91035063	missense	probably damaging	1.00
R6185:Chd9	UTSW	8	91049137	missense	probably damaging	1.00
R6246:Chd9	UTSW	8	90932417	missense	probably damaging	1.00
R6292:Chd9	UTSW	8	90932922	missense	probably benign	0.05
R6305:Chd9	UTSW	8	91030546	missense	possibly damaging	0.93
R6348:Chd9	UTSW	8	91011275	missense	possibly damaging	0.95
R6438:Chd9	UTSW	8	90998521	missense	probably benign	0.02
R6470:Chd9	UTSW	8	90932798	missense	probably damaging	1.00
R6798:Chd9	UTSW	8	91051554	missense	possibly damaging	0.56
R6902:Chd9	UTSW	8	91042951	missense	probably damaging	1.00
R6908:Chd9	UTSW	8	90956416	missense	probably benign	0.02
R6929:Chd9	UTSW	8	91042945	missense	probably damaging	1.00
R6969:Chd9	UTSW	8	90978914	missense	probably benign	0.34
R7043:Chd9	UTSW	8	91034215	utr 3 prime	probably benign
R7094:Chd9	UTSW	8	90989561	missense	unknown
R7126:Chd9	UTSW	8	91015225	missense	unknown
R7182:Chd9	UTSW	8	91006622	missense	unknown
R7219:Chd9	UTSW	8	91001766	missense	unknown
R7260:Chd9	UTSW	8	90994543	missense	unknown
R7293:Chd9	UTSW	8	91034079	missense	unknown
R7303:Chd9	UTSW	8	91051904	missense	unknown
R7358:Chd9	UTSW	8	90983487	missense	unknown
R7358:Chd9	UTSW	8	91034218	missense	unknown
R7451:Chd9	UTSW	8	91033790	frame shift	probably null
R7451:Chd9	UTSW	8	91033818	missense	probably benign	0.27
R7456:Chd9	UTSW	8	90932525	nonsense	probably null
R7481:Chd9	UTSW	8	90956438	missense	unknown
R7532:Chd9	UTSW	8	90994565	missense	unknown
R7570:Chd9	UTSW	8	90994580	missense	unknown
R7611:Chd9	UTSW	8	91036389	missense	probably damaging	1.00
R7673:Chd9	UTSW	8	91051697	missense	probably damaging	0.96
R7723:Chd9	UTSW	8	91015209	missense	unknown
R7739:Chd9	UTSW	8	91035025	missense	probably damaging	1.00
R7759:Chd9	UTSW	8	90977550	critical splice donor site	probably null
R7916:Chd9	UTSW	8	91035056	nonsense	probably null
R7921:Chd9	UTSW	8	91042281	critical splice donor site	probably null
R7957:Chd9	UTSW	8	91051698	missense	probably damaging	0.99
R7972:Chd9	UTSW	8	91005767	missense	unknown
R8108:Chd9	UTSW	8	90933224	missense	unknown
R8115:Chd9	UTSW	8	91036332	missense	probably damaging	0.99
R8165:Chd9	UTSW	8	91041141	missense	probably damaging	1.00
R8171:Chd9	UTSW	8	91025387	missense	possibly damaging	0.92
R8186:Chd9	UTSW	8	90998605	missense	unknown
R8208:Chd9	UTSW	8	91037263	splice site	probably null
R8256:Chd9	UTSW	8	90933501	missense	unknown
R8281:Chd9	UTSW	8	91036597	missense	probably damaging	1.00
R8504:Chd9	UTSW	8	90996844	missense	unknown
R8836:Chd9	UTSW	8	91041184	missense	probably damaging	0.99
R8892:Chd9	UTSW	8	90933840	missense	unknown
R8985:Chd9	UTSW	8	90994473	missense	unknown
R9029:Chd9	UTSW	8	90956570	missense	unknown
R9030:Chd9	UTSW	8	90956570	missense	unknown
R9038:Chd9	UTSW	8	90989605	missense	unknown
R9081:Chd9	UTSW	8	90977516	nonsense	probably null
R9134:Chd9	UTSW	8	90933126	missense	unknown
R9205:Chd9	UTSW	8	91030642	missense	probably benign	0.01
R9309:Chd9	UTSW	8	91006691	missense	unknown
R9375:Chd9	UTSW	8	90998707	critical splice donor site	probably null
R9449:Chd9	UTSW	8	90932546	missense	unknown
R9547:Chd9	UTSW	8	90956558	missense	unknown
R9573:Chd9	UTSW	8	90977674	missense	unknown
R9576:Chd9	UTSW	8	90932666	missense	unknown
R9601:Chd9	UTSW	8	91005732	nonsense	probably null
R9613:Chd9	UTSW	8	90956522	nonsense	probably null
R9639:Chd9	UTSW	8	91034212	missense	probably null
R9718:Chd9	UTSW	8	90986173	missense	unknown
R9762:Chd9	UTSW	8	90986113	missense	unknown
R9764:Chd9	UTSW	8	90994592	missense	unknown
R9790:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
R9791:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
RF007:Chd9	UTSW	8	91033950	missense	possibly damaging	0.66
X0065:Chd9	UTSW	8	91036572	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGTCCCTTTTCACCAGG -3'
(R):5'- TAATATAAGCGCGTGTACCCACC -3'

Sequencing Primer
(F):5'- TCCCTTTTCACCAGGTGGGG -3'
(R):5'- GCGTGTACCCACCCACCC -3'

Posted On

2022-11-14