Incidental Mutation 'R9746:Ncapd3'
ID 732129
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Name non-SMC condensin II complex, subunit D3
Synonyms 4632407J06Rik, 2810487N22Rik, B130055D15Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 26941471-27006611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26974655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 709 (R709H)
Ref Sequence ENSEMBL: ENSMUSP00000083374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073127
AA Change: R709H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: R709H

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086198
AA Change: R709H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: R709H

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216677
AA Change: R709H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 26,963,649 (GRCm39) missense probably benign
IGL00544:Ncapd3 APN 9 26,974,634 (GRCm39) missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 26,983,120 (GRCm39) missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 26,983,261 (GRCm39) critical splice donor site probably null
IGL02073:Ncapd3 APN 9 26,974,612 (GRCm39) missense probably benign 0.03
IGL02083:Ncapd3 APN 9 26,963,117 (GRCm39) missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 26,961,624 (GRCm39) missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27,000,598 (GRCm39) missense probably benign 0.08
IGL02437:Ncapd3 APN 9 26,975,264 (GRCm39) splice site probably benign
IGL02861:Ncapd3 APN 9 26,981,195 (GRCm39) missense probably benign 0.00
IGL03202:Ncapd3 APN 9 26,983,011 (GRCm39) splice site probably benign
IGL03219:Ncapd3 APN 9 26,975,169 (GRCm39) splice site probably benign
IGL03252:Ncapd3 APN 9 26,962,745 (GRCm39) missense probably damaging 1.00
pevensie UTSW 9 26,997,342 (GRCm39) missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 26,963,105 (GRCm39) missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 26,963,105 (GRCm39) missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 26,967,407 (GRCm39) missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 26,969,179 (GRCm39) missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 26,975,401 (GRCm39) splice site probably benign
R0565:Ncapd3 UTSW 9 26,999,294 (GRCm39) missense probably benign 0.00
R0601:Ncapd3 UTSW 9 26,952,803 (GRCm39) missense probably benign 0.05
R0671:Ncapd3 UTSW 9 26,998,773 (GRCm39) missense probably benign 0.00
R0673:Ncapd3 UTSW 9 26,998,773 (GRCm39) missense probably benign 0.00
R0842:Ncapd3 UTSW 9 26,948,380 (GRCm39) missense probably benign 0.01
R1178:Ncapd3 UTSW 9 26,952,717 (GRCm39) missense probably benign
R1366:Ncapd3 UTSW 9 26,969,236 (GRCm39) missense probably damaging 1.00
R1432:Ncapd3 UTSW 9 26,981,168 (GRCm39) splice site probably benign
R1439:Ncapd3 UTSW 9 26,998,862 (GRCm39) critical splice donor site probably null
R1532:Ncapd3 UTSW 9 26,994,656 (GRCm39) nonsense probably null
R2131:Ncapd3 UTSW 9 26,994,642 (GRCm39) missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 26,999,845 (GRCm39) missense probably benign 0.01
R2238:Ncapd3 UTSW 9 26,978,320 (GRCm39) missense probably benign
R2258:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2259:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2260:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2297:Ncapd3 UTSW 9 26,952,797 (GRCm39) nonsense probably null
R2877:Ncapd3 UTSW 9 26,955,783 (GRCm39) splice site probably null
R3612:Ncapd3 UTSW 9 26,961,653 (GRCm39) missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 26,963,645 (GRCm39) missense probably benign 0.00
R3791:Ncapd3 UTSW 9 26,963,931 (GRCm39) missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27,000,679 (GRCm39) splice site probably null
R4297:Ncapd3 UTSW 9 26,963,623 (GRCm39) missense probably benign
R4299:Ncapd3 UTSW 9 26,963,623 (GRCm39) missense probably benign
R4441:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27,005,911 (GRCm39) missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27,006,038 (GRCm39) unclassified probably benign
R4790:Ncapd3 UTSW 9 26,963,146 (GRCm39) missense probably benign 0.00
R4835:Ncapd3 UTSW 9 26,997,342 (GRCm39) missense probably damaging 1.00
R4919:Ncapd3 UTSW 9 26,963,071 (GRCm39) missense possibly damaging 0.95
R4928:Ncapd3 UTSW 9 26,983,031 (GRCm39) nonsense probably null
R4939:Ncapd3 UTSW 9 26,975,165 (GRCm39) critical splice donor site probably null
R4980:Ncapd3 UTSW 9 26,974,591 (GRCm39) missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 26,983,062 (GRCm39) missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 26,963,015 (GRCm39) missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 26,999,349 (GRCm39) small deletion probably benign
R5656:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R5840:Ncapd3 UTSW 9 27,006,054 (GRCm39) missense probably benign 0.00
R5900:Ncapd3 UTSW 9 26,978,265 (GRCm39) missense probably benign 0.26
R6093:Ncapd3 UTSW 9 26,967,454 (GRCm39) missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 26,975,278 (GRCm39) missense probably benign 0.00
R6249:Ncapd3 UTSW 9 26,999,349 (GRCm39) small deletion probably benign
R6428:Ncapd3 UTSW 9 26,963,960 (GRCm39) splice site probably null
R6432:Ncapd3 UTSW 9 26,955,805 (GRCm39) missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 26,974,712 (GRCm39) missense probably benign 0.03
R6459:Ncapd3 UTSW 9 26,963,051 (GRCm39) missense probably benign 0.00
R6567:Ncapd3 UTSW 9 26,978,300 (GRCm39) missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 26,998,852 (GRCm39) missense probably benign
R6862:Ncapd3 UTSW 9 26,942,105 (GRCm39) missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 26,961,655 (GRCm39) missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 26,981,254 (GRCm39) missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 26,978,315 (GRCm39) missense probably benign 0.01
R7541:Ncapd3 UTSW 9 26,978,336 (GRCm39) missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 26,983,144 (GRCm39) missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 26,966,801 (GRCm39) missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 26,966,801 (GRCm39) missense possibly damaging 0.47
R7815:Ncapd3 UTSW 9 26,974,736 (GRCm39) nonsense probably null
R7876:Ncapd3 UTSW 9 26,956,519 (GRCm39) critical splice donor site probably null
R7913:Ncapd3 UTSW 9 26,959,522 (GRCm39) nonsense probably null
R8068:Ncapd3 UTSW 9 26,974,657 (GRCm39) missense possibly damaging 0.66
R8147:Ncapd3 UTSW 9 26,942,014 (GRCm39) start gained probably benign
R8197:Ncapd3 UTSW 9 26,997,329 (GRCm39) missense probably damaging 0.98
R8264:Ncapd3 UTSW 9 27,006,038 (GRCm39) unclassified probably benign
R8353:Ncapd3 UTSW 9 26,983,100 (GRCm39) missense probably benign 0.03
R8539:Ncapd3 UTSW 9 26,959,520 (GRCm39) missense probably benign
R8839:Ncapd3 UTSW 9 27,005,730 (GRCm39) missense
R8917:Ncapd3 UTSW 9 26,999,297 (GRCm39) missense probably benign
R8997:Ncapd3 UTSW 9 26,959,577 (GRCm39) missense probably damaging 1.00
R9215:Ncapd3 UTSW 9 26,975,386 (GRCm39) missense possibly damaging 0.51
R9393:Ncapd3 UTSW 9 26,962,682 (GRCm39) missense possibly damaging 0.54
R9412:Ncapd3 UTSW 9 26,967,451 (GRCm39) nonsense probably null
R9688:Ncapd3 UTSW 9 26,967,349 (GRCm39) missense probably benign 0.01
R9749:Ncapd3 UTSW 9 26,956,873 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACCAGAGAAATCCTGAAGATGC -3'
(R):5'- AACTGCTTAAATGGGCCAGAATC -3'

Sequencing Primer
(F):5'- CAGAAGTTGATACCCTTTCAGTGAGG -3'
(R):5'- CTGCTTAAATGGGCCAGAATCTAAAG -3'
Posted On 2022-11-14