Incidental Mutation 'R9746:Tgm4'
ID 732134
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Name transglutaminase 4 (prostate)
Synonyms 9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 123034726-123067561 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123046569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 162 (K162N)
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026893
AA Change: K162N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: K162N

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,031 H307L probably benign Het
Acnat1 A T 4: 49,450,652 L153H probably damaging Het
Actn4 A T 7: 28,919,006 D76E probably benign Het
Afdn A C 17: 13,846,520 M640L probably benign Het
Angpt1 A T 15: 42,676,441 F7L probably benign Het
Ap3b2 A G 7: 81,476,344 F373S probably damaging Het
Armc2 T A 10: 41,924,461 Y650F probably damaging Het
Atg2b G T 12: 105,663,938 T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 54,975,110 probably null Het
Capn8 G A 1: 182,611,105 probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cfap54 T C 10: 92,801,219 N3103D probably benign Het
Chd9 G A 8: 91,011,435 R1565Q unknown Het
Cir1 G A 2: 73,303,808 T139I probably damaging Het
Cmah T C 13: 24,435,690 probably null Het
Cnpy1 T C 5: 28,245,802 D2G probably damaging Het
Dennd4a A T 9: 64,894,511 T979S probably benign Het
Dnah11 T A 12: 117,878,576 K4423* probably null Het
Dnajb4 A G 3: 152,186,683 I171T possibly damaging Het
Dpm1 A T 2: 168,230,387 probably null Het
Dtwd1 A G 2: 126,154,675 T27A probably benign Het
Ep400 C T 5: 110,742,006 D464N unknown Het
Epb42 A T 2: 121,024,610 I498N probably benign Het
Fhod1 A G 8: 105,337,416 V219A unknown Het
Gabrb2 A T 11: 42,626,609 E419D probably benign Het
Galnt18 A T 7: 111,471,961 N615K possibly damaging Het
Gm13084 T C 4: 143,810,316 T482A probably benign Het
Gm29106 T A 1: 118,199,524 H315Q possibly damaging Het
Gprin2 G T 14: 34,195,658 Q52K probably benign Het
Grm4 A T 17: 27,438,791 Y414N probably damaging Het
Gulo C A 14: 65,988,181 probably null Het
H2-M1 A C 17: 36,670,105 V313G possibly damaging Het
Hectd3 T C 4: 116,995,754 W118R probably damaging Het
Hs6st3 G A 14: 119,869,080 C300Y probably damaging Het
Il1rl2 T A 1: 40,365,359 S547T possibly damaging Het
Kank1 G T 19: 25,409,508 V182F probably damaging Het
Kif20b T A 19: 34,950,749 L1137* probably null Het
Klhl7 A G 5: 24,126,820 probably null Het
Krt13 T A 11: 100,121,161 D112V possibly damaging Het
Ltbr A G 6: 125,313,101 V71A probably benign Het
Ly6g T C 15: 75,158,609 V92A probably benign Het
Map2k3 G A 11: 60,932,103 probably benign Het
Mast2 A C 4: 116,311,730 D842E probably benign Het
Mpo T G 11: 87,803,523 M693R probably benign Het
Myo15 C A 11: 60,487,408 S212* probably null Het
Nadk2 C T 15: 9,106,736 R37* probably null Het
Ncapd3 G A 9: 27,063,359 R709H probably benign Het
Nck2 T A 1: 43,533,732 Y55* probably null Het
Neurl4 A G 11: 69,907,475 D777G probably damaging Het
Npr2 G A 4: 43,633,527 V224M possibly damaging Het
Nptx2 T A 5: 144,548,140 S148T probably benign Het
Nr1d1 T C 11: 98,770,334 T369A probably benign Het
Nub1 T G 5: 24,703,485 F411V probably damaging Het
Nup188 T A 2: 30,304,288 Y158N probably damaging Het
Olfr1031 A G 2: 85,992,747 Y310C probably benign Het
Olfr513 A G 7: 108,755,432 N192S probably benign Het
Olfr716 A T 7: 107,147,453 I46F probably benign Het
Olfr804 A T 10: 129,705,339 I154F probably damaging Het
Olfr897-ps1 T A 9: 38,309,632 I279K unknown Het
Orc2 C T 1: 58,497,451 G85S probably damaging Het
Pak1ip1 T A 13: 41,009,267 V182D probably damaging Het
Parvg T G 15: 84,326,223 C30W probably benign Het
Pcdha1 T A 18: 36,932,660 D792E probably benign Het
Ppp1r13b G T 12: 111,833,808 Q635K probably benign Het
Psg16 A G 7: 17,098,161 I341V probably benign Het
Psme4 C T 11: 30,876,868 Q1796* probably null Het
Ptn T G 6: 36,715,764 probably null Het
Rapsn C T 2: 91,045,478 P400L probably damaging Het
Rasal1 G A 5: 120,662,293 G207D probably damaging Het
Rdx A G 9: 52,063,578 I5V probably benign Het
Rpf1 A G 3: 146,517,778 I105T probably damaging Het
Rps15a A T 7: 118,109,997 F79I possibly damaging Het
Rwdd2b G A 16: 87,436,753 P153L probably benign Het
Scaf11 G A 15: 96,420,417 S422L probably damaging Het
Serpinb3b T A 1: 107,154,673 E287V possibly damaging Het
Sgta T C 10: 81,051,284 D49G possibly damaging Het
Sin3a T A 9: 57,118,074 M1068K probably benign Het
Slc12a9 G A 5: 137,321,409 R615W probably damaging Het
Slc26a3 T A 12: 31,449,146 S151T probably benign Het
Slc4a8 C A 15: 100,783,840 H111N probably damaging Het
Syngr1 G A 15: 80,091,458 R22K probably benign Het
Tars2 A T 3: 95,754,765 V25E probably benign Het
Tbx15 A G 3: 99,352,331 Y506C probably damaging Het
Tmem253 A G 14: 52,017,982 E83G probably damaging Het
Trp73 G A 4: 154,081,402 T118I probably damaging Het
Trpm7 A G 2: 126,822,658 S934P possibly damaging Het
Ttc23l G A 15: 10,523,643 S330L probably benign Het
Tub A C 7: 109,025,638 D199A probably benign Het
Uri1 A C 7: 37,996,685 probably null Het
Usp16 C T 16: 87,479,232 A486V probably benign Het
Vmn1r12 A G 6: 57,159,541 I208V probably benign Het
Vmn2r116 A T 17: 23,401,823 M844L probably benign Het
Vmn2r13 C T 5: 109,191,907 probably null Het
Xpnpep1 T C 19: 53,013,461 D118G probably damaging Het
Zfp111 G A 7: 24,198,642 P516S possibly damaging Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0644:Tgm4 UTSW 9 123051458 missense probably damaging 1.00
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4407:Tgm4 UTSW 9 123056530 missense probably damaging 1.00
R4752:Tgm4 UTSW 9 123051386 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6956:Tgm4 UTSW 9 123064703 missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7369:Tgm4 UTSW 9 123056684 critical splice donor site probably null
R7802:Tgm4 UTSW 9 123051336 intron probably benign
R8219:Tgm4 UTSW 9 123045052 missense probably benign
R8787:Tgm4 UTSW 9 123061845 missense probably damaging 1.00
R8936:Tgm4 UTSW 9 123040476 missense possibly damaging 0.92
R9045:Tgm4 UTSW 9 123048551 missense possibly damaging 0.94
R9328:Tgm4 UTSW 9 123056632 missense possibly damaging 0.93
R9359:Tgm4 UTSW 9 123052772 missense probably damaging 1.00
R9403:Tgm4 UTSW 9 123052772 missense probably damaging 1.00
R9471:Tgm4 UTSW 9 123040379 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATGTACAATGTATTGCTGTGAC -3'
(R):5'- AGCTTAGTAGTCCTTTCAGGCC -3'

Sequencing Primer
(F):5'- GTACAATGTATTGCTGTGACCCTTTC -3'
(R):5'- AGGCCACTTTCACACTTGTG -3'
Posted On 2022-11-14