Incidental Mutation 'R9746:Cfap54'
ID 732137
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 92611481-92917480 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92637081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 3103 (N3103D)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: N3038D
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: N3038D

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212902
AA Change: N3103D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 92,917,385 (GRCm39) missense unknown
IGL02034:Cfap54 APN 10 92,897,347 (GRCm39) missense probably damaging 0.99
IGL02082:Cfap54 APN 10 92,917,320 (GRCm39) missense unknown
IGL02434:Cfap54 APN 10 92,902,616 (GRCm39) missense probably benign 0.20
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0040:Cfap54 UTSW 10 92,812,901 (GRCm39) missense probably benign 0.33
R0044:Cfap54 UTSW 10 92,871,295 (GRCm39) missense probably null 0.46
R0086:Cfap54 UTSW 10 92,864,456 (GRCm39) missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 92,864,514 (GRCm39) missense probably damaging 1.00
R0194:Cfap54 UTSW 10 92,870,524 (GRCm39) unclassified probably benign
R0234:Cfap54 UTSW 10 92,735,022 (GRCm39) nonsense probably null
R0308:Cfap54 UTSW 10 92,721,226 (GRCm39) missense unknown
R0332:Cfap54 UTSW 10 92,871,319 (GRCm39) missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92,612,075 (GRCm39) missense probably benign 0.00
R0433:Cfap54 UTSW 10 92,814,942 (GRCm39) splice site probably benign
R0436:Cfap54 UTSW 10 92,874,837 (GRCm39) missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92,710,805 (GRCm39) critical splice donor site probably null
R0523:Cfap54 UTSW 10 92,744,745 (GRCm39) utr 3 prime probably benign
R0551:Cfap54 UTSW 10 92,860,984 (GRCm39) missense probably benign 0.35
R0595:Cfap54 UTSW 10 92,720,598 (GRCm39) missense unknown
R0617:Cfap54 UTSW 10 92,665,512 (GRCm39) splice site probably benign
R0632:Cfap54 UTSW 10 92,720,958 (GRCm39) missense unknown
R0730:Cfap54 UTSW 10 92,870,599 (GRCm39) missense probably benign 0.05
R0786:Cfap54 UTSW 10 92,803,397 (GRCm39) missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92,706,531 (GRCm39) missense unknown
R1004:Cfap54 UTSW 10 92,902,558 (GRCm39) splice site probably benign
R1033:Cfap54 UTSW 10 92,675,311 (GRCm39) missense probably benign 0.07
R1168:Cfap54 UTSW 10 92,773,782 (GRCm39) missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92,711,856 (GRCm39) missense unknown
R1429:Cfap54 UTSW 10 92,656,900 (GRCm39) missense probably benign 0.01
R1443:Cfap54 UTSW 10 92,768,583 (GRCm39) missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1557:Cfap54 UTSW 10 92,820,089 (GRCm39) missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92,768,502 (GRCm39) missense probably damaging 1.00
R1690:Cfap54 UTSW 10 92,871,304 (GRCm39) missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R1756:Cfap54 UTSW 10 92,883,923 (GRCm39) missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably null
R1835:Cfap54 UTSW 10 92,798,237 (GRCm39) missense probably benign 0.35
R1889:Cfap54 UTSW 10 92,870,572 (GRCm39) missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92,720,564 (GRCm39) missense unknown
R1958:Cfap54 UTSW 10 92,833,204 (GRCm39) missense probably benign 0.18
R2005:Cfap54 UTSW 10 92,720,630 (GRCm39) missense unknown
R2018:Cfap54 UTSW 10 92,852,466 (GRCm39) missense probably benign 0.00
R2045:Cfap54 UTSW 10 92,874,671 (GRCm39) splice site probably null
R2059:Cfap54 UTSW 10 92,778,841 (GRCm39) unclassified probably benign
R2100:Cfap54 UTSW 10 92,837,799 (GRCm39) missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92,722,229 (GRCm39) missense unknown
R2392:Cfap54 UTSW 10 92,860,873 (GRCm39) critical splice donor site probably null
R2508:Cfap54 UTSW 10 92,833,236 (GRCm39) missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92,776,017 (GRCm39) missense probably damaging 1.00
R2857:Cfap54 UTSW 10 92,881,144 (GRCm39) missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3108:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3157:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3158:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3159:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3161:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92,721,286 (GRCm39) missense unknown
R3730:Cfap54 UTSW 10 92,847,335 (GRCm39) nonsense probably null
R3770:Cfap54 UTSW 10 92,714,398 (GRCm39) missense unknown
R3776:Cfap54 UTSW 10 92,880,962 (GRCm39) missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92,740,206 (GRCm39) utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92,778,735 (GRCm39) unclassified probably benign
R3834:Cfap54 UTSW 10 92,636,985 (GRCm39) splice site probably benign
R3891:Cfap54 UTSW 10 92,874,708 (GRCm39) missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92,665,619 (GRCm39) missense probably benign 0.03
R3973:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R4190:Cfap54 UTSW 10 92,720,885 (GRCm39) missense unknown
R4389:Cfap54 UTSW 10 92,803,362 (GRCm39) missense probably benign 0.37
R4542:Cfap54 UTSW 10 92,860,991 (GRCm39) missense probably benign 0.12
R4564:Cfap54 UTSW 10 92,675,402 (GRCm39) unclassified probably benign
R4576:Cfap54 UTSW 10 92,879,090 (GRCm39) critical splice donor site probably null
R4620:Cfap54 UTSW 10 92,805,619 (GRCm39) missense probably benign 0.01
R4714:Cfap54 UTSW 10 92,651,780 (GRCm39) missense probably benign 0.01
R4762:Cfap54 UTSW 10 92,897,315 (GRCm39) splice site probably null
R4776:Cfap54 UTSW 10 92,808,556 (GRCm39) missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92,672,339 (GRCm39) nonsense probably null
R4827:Cfap54 UTSW 10 92,737,937 (GRCm39) utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92,803,390 (GRCm39) missense probably benign 0.01
R4965:Cfap54 UTSW 10 92,902,661 (GRCm39) missense probably benign 0.23
R5001:Cfap54 UTSW 10 92,800,396 (GRCm39) missense probably benign 0.01
R5060:Cfap54 UTSW 10 92,875,013 (GRCm39) missense probably damaging 1.00
R5067:Cfap54 UTSW 10 92,902,628 (GRCm39) missense probably benign 0.17
R5069:Cfap54 UTSW 10 92,773,636 (GRCm39) missense probably benign
R5094:Cfap54 UTSW 10 92,734,861 (GRCm39) utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92,773,753 (GRCm39) missense probably benign 0.03
R5127:Cfap54 UTSW 10 92,722,249 (GRCm39) splice site probably null
R5143:Cfap54 UTSW 10 92,865,020 (GRCm39) missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92,773,700 (GRCm39) missense probably benign 0.00
R5158:Cfap54 UTSW 10 92,901,059 (GRCm39) missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92,880,885 (GRCm39) splice site probably null
R5256:Cfap54 UTSW 10 92,770,953 (GRCm39) nonsense probably null
R5266:Cfap54 UTSW 10 92,651,764 (GRCm39) missense probably benign 0.16
R5304:Cfap54 UTSW 10 92,656,968 (GRCm39) missense probably damaging 0.97
R5369:Cfap54 UTSW 10 92,897,119 (GRCm39) intron probably benign
R5406:Cfap54 UTSW 10 92,837,720 (GRCm39) missense probably benign 0.33
R5471:Cfap54 UTSW 10 92,864,522 (GRCm39) missense probably damaging 1.00
R5485:Cfap54 UTSW 10 92,864,979 (GRCm39) missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92,808,470 (GRCm39) missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92,808,473 (GRCm39) nonsense probably null
R5614:Cfap54 UTSW 10 92,880,911 (GRCm39) missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92,814,879 (GRCm39) nonsense probably null
R5797:Cfap54 UTSW 10 92,803,438 (GRCm39) missense probably benign 0.11
R5859:Cfap54 UTSW 10 92,852,386 (GRCm39) nonsense probably null
R5878:Cfap54 UTSW 10 92,800,423 (GRCm39) missense probably benign 0.01
R5910:Cfap54 UTSW 10 92,901,043 (GRCm39) missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R5994:Cfap54 UTSW 10 92,874,943 (GRCm39) missense probably damaging 0.99
R6080:Cfap54 UTSW 10 92,881,197 (GRCm39) missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 92,874,771 (GRCm39) missense probably damaging 1.00
R6296:Cfap54 UTSW 10 92,902,708 (GRCm39) missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92,803,354 (GRCm39) missense probably benign 0.04
R6545:Cfap54 UTSW 10 92,672,319 (GRCm39) missense probably benign 0.31
R6570:Cfap54 UTSW 10 92,651,820 (GRCm39) missense unknown
R6597:Cfap54 UTSW 10 92,834,902 (GRCm39) missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6703:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6720:Cfap54 UTSW 10 92,656,981 (GRCm39) missense probably benign 0.07
R6841:Cfap54 UTSW 10 92,710,877 (GRCm39) missense unknown
R6910:Cfap54 UTSW 10 92,672,374 (GRCm39) missense probably benign 0.29
R6953:Cfap54 UTSW 10 92,830,540 (GRCm39) missense probably benign 0.19
R7009:Cfap54 UTSW 10 92,710,881 (GRCm39) missense unknown
R7129:Cfap54 UTSW 10 92,852,433 (GRCm39) missense probably benign 0.06
R7131:Cfap54 UTSW 10 92,656,966 (GRCm39) missense probably benign 0.03
R7171:Cfap54 UTSW 10 92,612,072 (GRCm39) missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92,773,590 (GRCm39) missense unknown
R7225:Cfap54 UTSW 10 92,740,236 (GRCm39) missense unknown
R7270:Cfap54 UTSW 10 92,675,320 (GRCm39) missense probably benign 0.03
R7323:Cfap54 UTSW 10 92,637,000 (GRCm39) missense probably benign 0.00
R7380:Cfap54 UTSW 10 92,883,840 (GRCm39) missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92,720,565 (GRCm39) missense unknown
R7411:Cfap54 UTSW 10 92,704,617 (GRCm39) missense unknown
R7503:Cfap54 UTSW 10 92,723,298 (GRCm39) splice site probably null
R7622:Cfap54 UTSW 10 92,792,806 (GRCm39) missense unknown
R7679:Cfap54 UTSW 10 92,803,374 (GRCm39) missense probably benign 0.01
R7776:Cfap54 UTSW 10 92,704,603 (GRCm39) missense unknown
R7844:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R7980:Cfap54 UTSW 10 92,817,922 (GRCm39) missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92,737,941 (GRCm39) missense unknown
R8101:Cfap54 UTSW 10 92,720,658 (GRCm39) missense unknown
R8119:Cfap54 UTSW 10 92,704,672 (GRCm39) missense unknown
R8134:Cfap54 UTSW 10 92,714,378 (GRCm39) missense unknown
R8168:Cfap54 UTSW 10 92,744,739 (GRCm39) missense unknown
R8179:Cfap54 UTSW 10 92,833,178 (GRCm39) missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92,798,279 (GRCm39) missense unknown
R8436:Cfap54 UTSW 10 92,800,398 (GRCm39) missense unknown
R8505:Cfap54 UTSW 10 92,814,855 (GRCm39) missense probably benign 0.03
R8671:Cfap54 UTSW 10 92,790,934 (GRCm39) missense unknown
R8716:Cfap54 UTSW 10 92,800,494 (GRCm39) missense probably benign 0.00
R8816:Cfap54 UTSW 10 92,714,454 (GRCm39) missense unknown
R8822:Cfap54 UTSW 10 92,875,003 (GRCm39) missense probably benign 0.09
R8827:Cfap54 UTSW 10 92,774,110 (GRCm39) missense unknown
R8920:Cfap54 UTSW 10 92,776,199 (GRCm39) critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 92,837,685 (GRCm39) missense probably damaging 0.99
R8954:Cfap54 UTSW 10 92,879,255 (GRCm39) missense probably damaging 1.00
R8963:Cfap54 UTSW 10 92,864,562 (GRCm39) nonsense probably null
R9010:Cfap54 UTSW 10 92,734,921 (GRCm39) missense unknown
R9017:Cfap54 UTSW 10 92,651,883 (GRCm39) missense probably benign 0.07
R9093:Cfap54 UTSW 10 92,651,770 (GRCm39) missense probably benign 0.03
R9095:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92,820,097 (GRCm39) missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92,830,579 (GRCm39) missense probably benign 0.10
R9196:Cfap54 UTSW 10 92,873,753 (GRCm39) missense probably benign 0.22
R9203:Cfap54 UTSW 10 92,880,990 (GRCm39) missense probably benign 0.30
R9258:Cfap54 UTSW 10 92,770,960 (GRCm39) missense unknown
R9275:Cfap54 UTSW 10 92,875,048 (GRCm39) missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92,805,565 (GRCm39) missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92,656,936 (GRCm39) missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92,798,177 (GRCm39) missense unknown
R9397:Cfap54 UTSW 10 92,833,147 (GRCm39) missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R9697:Cfap54 UTSW 10 92,792,851 (GRCm39) missense unknown
R9755:Cfap54 UTSW 10 92,757,230 (GRCm39) missense unknown
X0022:Cfap54 UTSW 10 92,768,476 (GRCm39) missense probably damaging 1.00
X0022:Cfap54 UTSW 10 92,714,465 (GRCm39) missense unknown
X0027:Cfap54 UTSW 10 92,837,750 (GRCm39) missense possibly damaging 0.86
X0027:Cfap54 UTSW 10 92,714,400 (GRCm39) missense unknown
Z1177:Cfap54 UTSW 10 92,814,888 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTCCTCAGATTCAGGGAG -3'
(R):5'- CAGCAGACATTCCTGATTAAGCTC -3'

Sequencing Primer
(F):5'- ACTCCTCAGATTCAGGGAGTGTATTC -3'
(R):5'- AGACATTCCTGATTAAGCTCAGCTC -3'
Posted On 2022-11-14