Incidental Mutation 'R9746:Psme4'
ID 732139
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 30826868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1796 (Q1796*)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably null
Transcript: ENSMUST00000041231
AA Change: Q1796*
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: Q1796*

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCAGCCACAGAAATCATGC -3'
(R):5'- ATGCTTAGCCTCCAATTTGATGG -3'

Sequencing Primer
(F):5'- TGCACATTAAAAGTACATCTAGCATG -3'
(R):5'- AGCCTCCAATTTGATGGTATTTTG -3'
Posted On 2022-11-14