Mutagenetix > Incidental Mutation

Incidental Mutation 'R9746:Myo15'

732141

Institutional Source

Beutler Lab

Gene Symbol

Myo15

Ensembl Gene

ENSMUSG00000042678

Gene Name

myosin XV

Synonyms

sh2; sh-2; Myo15a

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9746 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60469339-60528369 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 60487408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 212 (S212*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000071880
AA Change: S1381*

SMART Domains

Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: S1381*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1955	1974	N/A	INTRINSIC
low complexity region	1992	2006	N/A	INTRINSIC
MyTH4	2049	2195	1.8e-42	SMART
low complexity region	2396	2405	N/A	INTRINSIC
low complexity region	2451	2461	N/A	INTRINSIC
Blast:MYSc	2665	2848	2e-14	BLAST
SH3	2851	2933	1.55e-4	SMART
low complexity region	2949	2962	N/A	INTRINSIC
MyTH4	3031	3185	5.59e-48	SMART
B41	3188	3400	6.94e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000081823
AA Change: S194*

SMART Domains

Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: S194*

Domain	Start	End	E-Value	Type
MYSc	13	697	N/A	SMART
IQ	698	720	1.63e-1	SMART
IQ	721	743	1.77e-2	SMART
IQ	744	766	2.97e2	SMART
low complexity region	787	801	N/A	INTRINSIC
MyTH4	844	990	1.8e-42	SMART
low complexity region	1191	1200	N/A	INTRINSIC
low complexity region	1246	1256	N/A	INTRINSIC
Blast:MYSc	1460	1643	7e-15	BLAST
SH3	1646	1728	1.55e-4	SMART
low complexity region	1744	1757	N/A	INTRINSIC
MyTH4	1826	1980	5.59e-48	SMART
B41	1983	2195	6.94e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000094135
AA Change: S1381*

SMART Domains

Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: S1381*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1974	1988	N/A	INTRINSIC
MyTH4	2031	2177	1.8e-42	SMART
low complexity region	2378	2387	N/A	INTRINSIC
low complexity region	2433	2443	N/A	INTRINSIC
Blast:MYSc	2647	2830	2e-14	BLAST
SH3	2833	2915	1.55e-4	SMART
low complexity region	2931	2944	N/A	INTRINSIC
MyTH4	3013	3167	5.59e-48	SMART
B41	3170	3382	6.94e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000126522
AA Change: S212*

SMART Domains

Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: S212*

Domain	Start	End	E-Value	Type
MYSc	34	716	N/A	SMART
IQ	717	739	1.63e-1	SMART
IQ	740	762	1.77e-2	SMART
IQ	763	785	2.97e2	SMART
low complexity region	806	820	N/A	INTRINSIC
MyTH4	863	1009	1.8e-42	SMART
low complexity region	1210	1219	N/A	INTRINSIC
low complexity region	1265	1275	N/A	INTRINSIC
Blast:MYSc	1479	1662	5e-15	BLAST
SH3	1665	1747	1.55e-4	SMART
low complexity region	1763	1776	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	T	A	1: 173,332,031	H307L	probably benign	Het
Acnat1	A	T	4: 49,450,652	L153H	probably damaging	Het
Actn4	A	T	7: 28,919,006	D76E	probably benign	Het
Afdn	A	C	17: 13,846,520	M640L	probably benign	Het
Angpt1	A	T	15: 42,676,441	F7L	probably benign	Het
Ap3b2	A	G	7: 81,476,344	F373S	probably damaging	Het
Armc2	T	A	10: 41,924,461	Y650F	probably damaging	Het
Atg2b	G	T	12: 105,663,938	T398K	possibly damaging	Het
Baz1a	CCATT	CCATTCATT	12: 54,975,110		probably null	Het
Capn8	G	A	1: 182,611,105		probably null	Het
Cdr1	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	X: 61,184,524		probably benign	Het
Cfap54	T	C	10: 92,801,219	N3103D	probably benign	Het
Chd9	G	A	8: 91,011,435	R1565Q	unknown	Het
Cir1	G	A	2: 73,303,808	T139I	probably damaging	Het
Cmah	T	C	13: 24,435,690		probably null	Het
Cnpy1	T	C	5: 28,245,802	D2G	probably damaging	Het
Dennd4a	A	T	9: 64,894,511	T979S	probably benign	Het
Dnah11	T	A	12: 117,878,576	K4423*	probably null	Het
Dnajb4	A	G	3: 152,186,683	I171T	possibly damaging	Het
Dpm1	A	T	2: 168,230,387		probably null	Het
Dtwd1	A	G	2: 126,154,675	T27A	probably benign	Het
Ep400	C	T	5: 110,742,006	D464N	unknown	Het
Epb42	A	T	2: 121,024,610	I498N	probably benign	Het
Fhod1	A	G	8: 105,337,416	V219A	unknown	Het
Gabrb2	A	T	11: 42,626,609	E419D	probably benign	Het
Galnt18	A	T	7: 111,471,961	N615K	possibly damaging	Het
Gm13084	T	C	4: 143,810,316	T482A	probably benign	Het
Gm29106	T	A	1: 118,199,524	H315Q	possibly damaging	Het
Gprin2	G	T	14: 34,195,658	Q52K	probably benign	Het
Grm4	A	T	17: 27,438,791	Y414N	probably damaging	Het
Gulo	C	A	14: 65,988,181		probably null	Het
H2-M1	A	C	17: 36,670,105	V313G	possibly damaging	Het
Hectd3	T	C	4: 116,995,754	W118R	probably damaging	Het
Hs6st3	G	A	14: 119,869,080	C300Y	probably damaging	Het
Il1rl2	T	A	1: 40,365,359	S547T	possibly damaging	Het
Kank1	G	T	19: 25,409,508	V182F	probably damaging	Het
Kif20b	T	A	19: 34,950,749	L1137*	probably null	Het
Klhl7	A	G	5: 24,126,820		probably null	Het
Krt13	T	A	11: 100,121,161	D112V	possibly damaging	Het
Ltbr	A	G	6: 125,313,101	V71A	probably benign	Het
Ly6g	T	C	15: 75,158,609	V92A	probably benign	Het
Map2k3	G	A	11: 60,932,103		probably benign	Het
Mast2	A	C	4: 116,311,730	D842E	probably benign	Het
Mpo	T	G	11: 87,803,523	M693R	probably benign	Het
Nadk2	C	T	15: 9,106,736	R37*	probably null	Het
Ncapd3	G	A	9: 27,063,359	R709H	probably benign	Het
Nck2	T	A	1: 43,533,732	Y55*	probably null	Het
Neurl4	A	G	11: 69,907,475	D777G	probably damaging	Het
Npr2	G	A	4: 43,633,527	V224M	possibly damaging	Het
Nptx2	T	A	5: 144,548,140	S148T	probably benign	Het
Nr1d1	T	C	11: 98,770,334	T369A	probably benign	Het
Nub1	T	G	5: 24,703,485	F411V	probably damaging	Het
Nup188	T	A	2: 30,304,288	Y158N	probably damaging	Het
Olfr1031	A	G	2: 85,992,747	Y310C	probably benign	Het
Olfr513	A	G	7: 108,755,432	N192S	probably benign	Het
Olfr716	A	T	7: 107,147,453	I46F	probably benign	Het
Olfr804	A	T	10: 129,705,339	I154F	probably damaging	Het
Olfr897-ps1	T	A	9: 38,309,632	I279K	unknown	Het
Orc2	C	T	1: 58,497,451	G85S	probably damaging	Het
Pak1ip1	T	A	13: 41,009,267	V182D	probably damaging	Het
Parvg	T	G	15: 84,326,223	C30W	probably benign	Het
Pcdha1	T	A	18: 36,932,660	D792E	probably benign	Het
Ppp1r13b	G	T	12: 111,833,808	Q635K	probably benign	Het
Psg16	A	G	7: 17,098,161	I341V	probably benign	Het
Psme4	C	T	11: 30,876,868	Q1796*	probably null	Het
Ptn	T	G	6: 36,715,764		probably null	Het
Rapsn	C	T	2: 91,045,478	P400L	probably damaging	Het
Rasal1	G	A	5: 120,662,293	G207D	probably damaging	Het
Rdx	A	G	9: 52,063,578	I5V	probably benign	Het
Rpf1	A	G	3: 146,517,778	I105T	probably damaging	Het
Rps15a	A	T	7: 118,109,997	F79I	possibly damaging	Het
Rwdd2b	G	A	16: 87,436,753	P153L	probably benign	Het
Scaf11	G	A	15: 96,420,417	S422L	probably damaging	Het
Serpinb3b	T	A	1: 107,154,673	E287V	possibly damaging	Het
Sgta	T	C	10: 81,051,284	D49G	possibly damaging	Het
Sin3a	T	A	9: 57,118,074	M1068K	probably benign	Het
Slc12a9	G	A	5: 137,321,409	R615W	probably damaging	Het
Slc26a3	T	A	12: 31,449,146	S151T	probably benign	Het
Slc4a8	C	A	15: 100,783,840	H111N	probably damaging	Het
Syngr1	G	A	15: 80,091,458	R22K	probably benign	Het
Tars2	A	T	3: 95,754,765	V25E	probably benign	Het
Tbx15	A	G	3: 99,352,331	Y506C	probably damaging	Het
Tgm4	A	T	9: 123,046,569	K162N	possibly damaging	Het
Tmem253	A	G	14: 52,017,982	E83G	probably damaging	Het
Trp73	G	A	4: 154,081,402	T118I	probably damaging	Het
Trpm7	A	G	2: 126,822,658	S934P	possibly damaging	Het
Ttc23l	G	A	15: 10,523,643	S330L	probably benign	Het
Tub	A	C	7: 109,025,638	D199A	probably benign	Het
Uri1	A	C	7: 37,996,685		probably null	Het
Usp16	C	T	16: 87,479,232	A486V	probably benign	Het
Vmn1r12	A	G	6: 57,159,541	I208V	probably benign	Het
Vmn2r116	A	T	17: 23,401,823	M844L	probably benign	Het
Vmn2r13	C	T	5: 109,191,907		probably null	Het
Xpnpep1	T	C	19: 53,013,461	D118G	probably damaging	Het
Zfp111	G	A	7: 24,198,642	P516S	possibly damaging	Het

Other mutations in Myo15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00845:Myo15	APN	11	60477779	missense	probably damaging	1.00
IGL01011:Myo15	APN	11	60476992	missense	probably benign	0.33
IGL01100:Myo15	APN	11	60511158	missense	probably damaging	1.00
IGL01357:Myo15	APN	11	60502289	splice site	probably benign
IGL01634:Myo15	APN	11	60495472	missense	probably damaging	1.00
IGL01763:Myo15	APN	11	60521738	missense	probably benign	0.07
IGL01901:Myo15	APN	11	60527434	utr 3 prime	probably benign
IGL01931:Myo15	APN	11	60496138	missense	probably damaging	1.00
IGL02006:Myo15	APN	11	60511128	missense	probably damaging	1.00
IGL02041:Myo15	APN	11	60506863	missense	probably damaging	0.99
IGL02094:Myo15	APN	11	60510647	unclassified	probably benign
IGL02122:Myo15	APN	11	60483466	missense	probably benign	0.23
IGL02153:Myo15	APN	11	60498397	missense	probably damaging	1.00
IGL02328:Myo15	APN	11	60526607	missense	probably benign	0.13
IGL02330:Myo15	APN	11	60477161	missense	possibly damaging	0.94
IGL02431:Myo15	APN	11	60510639	missense	possibly damaging	0.73
IGL02639:Myo15	APN	11	60478621	missense	probably benign
IGL02659:Myo15	APN	11	60491783	splice site	probably benign
IGL02800:Myo15	APN	11	60502369	missense	probably damaging	1.00
IGL02812:Myo15	APN	11	60477179	missense	probably benign	0.15
IGL02863:Myo15	APN	11	60478127	missense	probably damaging	1.00
IGL02873:Myo15	APN	11	60483482	missense	probably damaging	1.00
IGL02990:Myo15	APN	11	60479440	missense	probably benign	0.02
IGL03011:Myo15	APN	11	60509531	splice site	probably benign
IGL03243:Myo15	APN	11	60496518	missense	probably damaging	1.00
IGL03297:Myo15	APN	11	60479141	missense	probably damaging	1.00
parker	UTSW	11	60520914	critical splice donor site	probably null
Typhoon	UTSW	11	60487425	critical splice donor site	probably null
PIT4131001:Myo15	UTSW	11	60483127	missense	probably damaging	1.00
PIT4131001:Myo15	UTSW	11	60495454	missense	probably damaging	1.00
R0133:Myo15	UTSW	11	60477850	missense	possibly damaging	0.94
R0265:Myo15	UTSW	11	60514897	critical splice acceptor site	probably null
R0389:Myo15	UTSW	11	60478538	missense	probably benign
R0416:Myo15	UTSW	11	60511174	missense	probably damaging	1.00
R0449:Myo15	UTSW	11	60509596	missense	possibly damaging	0.92
R0477:Myo15	UTSW	11	60520914	critical splice donor site	probably null
R0543:Myo15	UTSW	11	60479051	missense	probably benign
R0546:Myo15	UTSW	11	60506313	missense	probably damaging	1.00
R0555:Myo15	UTSW	11	60521638	missense	probably damaging	1.00
R0639:Myo15	UTSW	11	60479336	missense	probably benign	0.12
R0723:Myo15	UTSW	11	60478977	missense	possibly damaging	0.94
R0837:Myo15	UTSW	11	60487251	missense	probably damaging	0.98
R0865:Myo15	UTSW	11	60491688	missense	probably damaging	1.00
R0899:Myo15	UTSW	11	60477185	missense	possibly damaging	0.87
R1022:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1024:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1035:Myo15	UTSW	11	60510558	unclassified	probably benign
R1109:Myo15	UTSW	11	60493066	missense	probably damaging	1.00
R1170:Myo15	UTSW	11	60479407	missense	probably benign	0.04
R1241:Myo15	UTSW	11	60499430	missense	possibly damaging	0.58
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1434:Myo15	UTSW	11	60504331	missense	probably benign	0.00
R1450:Myo15	UTSW	11	60495482	missense	probably damaging	1.00
R1456:Myo15	UTSW	11	60508202	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1548:Myo15	UTSW	11	60488238	missense	probably damaging	1.00
R1551:Myo15	UTSW	11	60492965	missense	possibly damaging	0.70
R1571:Myo15	UTSW	11	60518464	missense	probably damaging	1.00
R1662:Myo15	UTSW	11	60501701	missense	probably damaging	1.00
R1777:Myo15	UTSW	11	60514936	missense	probably benign
R1778:Myo15	UTSW	11	60478412	missense	possibly damaging	0.57
R1847:Myo15	UTSW	11	60499495	nonsense	probably null
R1875:Myo15	UTSW	11	60507528	missense	probably damaging	0.99
R1944:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R1945:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R2013:Myo15	UTSW	11	60494231	missense	probably damaging	1.00
R2107:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2108:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2112:Myo15	UTSW	11	60494168	missense	probably damaging	0.99
R2147:Myo15	UTSW	11	60510229	missense	possibly damaging	0.66
R2196:Myo15	UTSW	11	60510021	nonsense	probably null
R2207:Myo15	UTSW	11	60506034	missense	probably benign	0.01
R2245:Myo15	UTSW	11	60509099	missense	probably damaging	1.00
R2367:Myo15	UTSW	11	60517238	missense	probably damaging	0.99
R2374:Myo15	UTSW	11	60478843	missense	possibly damaging	0.88
R2438:Myo15	UTSW	11	60483052	missense	probably damaging	1.00
R3154:Myo15	UTSW	11	60479360	splice site	probably null
R3423:Myo15	UTSW	11	60510300	critical splice donor site	probably null
R3551:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3552:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3612:Myo15	UTSW	11	60477679	missense	probably damaging	1.00
R3620:Myo15	UTSW	11	60478642	missense	possibly damaging	0.63
R3713:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3714:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3715:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3783:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3784:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3785:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3786:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3787:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3894:Myo15	UTSW	11	60504319	missense	probably benign	0.00
R3962:Myo15	UTSW	11	60479828	missense	probably benign	0.00
R4082:Myo15	UTSW	11	60487196	missense	possibly damaging	0.92
R4555:Myo15	UTSW	11	60496937	missense	probably damaging	1.00
R4641:Myo15	UTSW	11	60503041	missense	probably damaging	1.00
R4665:Myo15	UTSW	11	60504879	critical splice acceptor site	probably null
R4713:Myo15	UTSW	11	60479930	missense	probably benign	0.21
R4820:Myo15	UTSW	11	60476915	missense	probably damaging	0.98
R5013:Myo15	UTSW	11	60491667	missense	probably damaging	1.00
R5051:Myo15	UTSW	11	60487425	critical splice donor site	probably null
R5187:Myo15	UTSW	11	60503614	missense	probably damaging	1.00
R5230:Myo15	UTSW	11	60502848	missense	possibly damaging	0.68
R5277:Myo15	UTSW	11	60477114	nonsense	probably null
R5345:Myo15	UTSW	11	60497538	missense	probably damaging	0.99
R5349:Myo15	UTSW	11	60493583	missense	probably damaging	1.00
R5356:Myo15	UTSW	11	60498366	missense	probably damaging	1.00
R5445:Myo15	UTSW	11	60520777	nonsense	probably null
R5477:Myo15	UTSW	11	60477677	missense	probably damaging	1.00
R5629:Myo15	UTSW	11	60479752	missense	probably benign
R5728:Myo15	UTSW	11	60488896	missense	probably damaging	1.00
R5818:Myo15	UTSW	11	60497951	missense	probably benign	0.06
R5952:Myo15	UTSW	11	60479420	missense	possibly damaging	0.50
R6338:Myo15	UTSW	11	60478133	missense	probably damaging	0.99
R6467:Myo15	UTSW	11	60526661	critical splice donor site	probably null
R6488:Myo15	UTSW	11	60478487	missense	possibly damaging	0.86
R6521:Myo15	UTSW	11	60502369	missense	probably damaging	1.00
R6645:Myo15	UTSW	11	60477292	missense	probably benign	0.00
R6702:Myo15	UTSW	11	60492992	missense	probably benign	0.16
R6703:Myo15	UTSW	11	60492992	missense	probably benign	0.16
R6821:Myo15	UTSW	11	60524475	missense	probably damaging	1.00
R6882:Myo15	UTSW	11	60524006	missense	probably damaging	1.00
R6908:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R6932:Myo15	UTSW	11	60499494	missense	probably damaging	1.00
R6958:Myo15	UTSW	11	60503625	missense	probably benign	0.07
R7041:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R7149:Myo15	UTSW	11	60510010	missense	possibly damaging	0.56
R7163:Myo15	UTSW	11	60498369	missense
R7229:Myo15	UTSW	11	60496495	missense	probably benign	0.08
R7347:Myo15	UTSW	11	60477961	missense	probably benign
R7368:Myo15	UTSW	11	60490915	splice site	probably null
R7392:Myo15	UTSW	11	60505976	missense
R7414:Myo15	UTSW	11	60483483	missense
R7461:Myo15	UTSW	11	60505152	missense
R7609:Myo15	UTSW	11	60488811	missense
R7613:Myo15	UTSW	11	60505152	missense
R7734:Myo15	UTSW	11	60510282	missense	probably benign
R7748:Myo15	UTSW	11	60504901	missense
R7767:Myo15	UTSW	11	60502096	missense
R7769:Myo15	UTSW	11	60509149	missense
R7894:Myo15	UTSW	11	60491137	missense
R7919:Myo15	UTSW	11	60526530	missense	probably damaging	1.00
R8100:Myo15	UTSW	11	60517190	missense	probably damaging	1.00
R8124:Myo15	UTSW	11	60507453	missense
R8129:Myo15	UTSW	11	60508200	missense
R8428:Myo15	UTSW	11	60496415	missense	probably damaging	1.00
R8706:Myo15	UTSW	11	60479617	missense	probably benign
R8735:Myo15	UTSW	11	60510853	critical splice acceptor site	probably null
R8739:Myo15	UTSW	11	60477262	missense	probably benign	0.06
R8790:Myo15	UTSW	11	60476536	missense	possibly damaging	0.73
R8790:Myo15	UTSW	11	60487221	missense
R8822:Myo15	UTSW	11	60476914	missense	probably damaging	0.99
R8907:Myo15	UTSW	11	60526608	missense
R8931:Myo15	UTSW	11	60477194	missense	probably benign
R9061:Myo15	UTSW	11	60502866	missense
R9124:Myo15	UTSW	11	60479126	missense	probably benign	0.37
R9297:Myo15	UTSW	11	60495073	missense	probably null
R9347:Myo15	UTSW	11	60483729	missense
R9417:Myo15	UTSW	11	60487417	missense
R9456:Myo15	UTSW	11	60501842	missense
R9460:Myo15	UTSW	11	60481740	critical splice donor site	probably null
R9615:Myo15	UTSW	11	60483494	missense
R9630:Myo15	UTSW	11	60517162	missense	probably damaging	1.00
X0021:Myo15	UTSW	11	60482359	nonsense	probably null
X0066:Myo15	UTSW	11	60478220	missense	probably damaging	1.00
X0067:Myo15	UTSW	11	60478618	missense	possibly damaging	0.88
Z1176:Myo15	UTSW	11	60488258	missense
Z1176:Myo15	UTSW	11	60498403	missense
Z1176:Myo15	UTSW	11	60524441	missense	probably damaging	1.00
Z1177:Myo15	UTSW	11	60477523	missense	probably damaging	1.00
Z1177:Myo15	UTSW	11	60488837	missense
Z1177:Myo15	UTSW	11	60495475	missense

Predicted Primers

PCR Primer
(F):5'- CTGGAGGCCTTTGGTAATGC -3'
(R):5'- CAGACAGCATGCATTCACAG -3'

Sequencing Primer
(F):5'- GAATGACAACTCCAGCCGCTTTG -3'
(R):5'- GCATGCATTCACAGAGTCTG -3'

Posted On

2022-11-14