Incidental Mutation 'R9746:Neurl4'
ID 732143
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Name neuralized E3 ubiquitin protein ligase 4
Synonyms 0610025P10Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69792545-69804648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69798301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 777 (D777G)
Ref Sequence ENSEMBL: ENSMUSP00000135277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061837] [ENSMUST00000108617] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000177138] [ENSMUST00000177476]
AlphaFold Q5NCX5
Predicted Effect probably damaging
Transcript: ENSMUST00000061837
AA Change: D799G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: D799G

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108617
AA Change: D777G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: D777G

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000132183
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133203
AA Change: D542G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284
AA Change: D542G

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177138
AA Change: D777G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: D777G

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177476
AA Change: D799G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: D799G

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69,795,413 (GRCm39) missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69,801,219 (GRCm39) missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69,797,925 (GRCm39) missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69,800,449 (GRCm39) missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69,796,616 (GRCm39) missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69,801,166 (GRCm39) missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69,797,161 (GRCm39) missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69,797,657 (GRCm39) missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69,799,891 (GRCm39) missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69,801,232 (GRCm39) missense probably benign 0.41
R0388:Neurl4 UTSW 11 69,802,559 (GRCm39) splice site probably benign
R0421:Neurl4 UTSW 11 69,799,360 (GRCm39) missense probably damaging 1.00
R0449:Neurl4 UTSW 11 69,796,393 (GRCm39) missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69,794,547 (GRCm39) critical splice donor site probably null
R1345:Neurl4 UTSW 11 69,794,702 (GRCm39) missense probably benign 0.21
R1536:Neurl4 UTSW 11 69,794,252 (GRCm39) nonsense probably null
R1642:Neurl4 UTSW 11 69,794,485 (GRCm39) missense probably benign 0.03
R1857:Neurl4 UTSW 11 69,796,361 (GRCm39) missense probably damaging 1.00
R1935:Neurl4 UTSW 11 69,797,959 (GRCm39) missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69,797,959 (GRCm39) missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69,794,036 (GRCm39) missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69,800,118 (GRCm39) missense probably benign
R2046:Neurl4 UTSW 11 69,799,523 (GRCm39) missense probably damaging 1.00
R2165:Neurl4 UTSW 11 69,794,047 (GRCm39) missense probably benign
R2393:Neurl4 UTSW 11 69,797,900 (GRCm39) missense probably damaging 1.00
R3810:Neurl4 UTSW 11 69,794,859 (GRCm39) missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69,799,887 (GRCm39) missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69,801,894 (GRCm39) missense probably benign 0.00
R4898:Neurl4 UTSW 11 69,793,997 (GRCm39) missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69,798,134 (GRCm39) missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69,801,913 (GRCm39) missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69,797,194 (GRCm39) missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69,801,742 (GRCm39) critical splice donor site probably null
R6791:Neurl4 UTSW 11 69,799,336 (GRCm39) missense probably damaging 1.00
R7029:Neurl4 UTSW 11 69,801,562 (GRCm39) missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69,801,088 (GRCm39) missense probably damaging 1.00
R7361:Neurl4 UTSW 11 69,802,905 (GRCm39) missense probably benign 0.01
R7367:Neurl4 UTSW 11 69,799,408 (GRCm39) missense probably damaging 1.00
R7804:Neurl4 UTSW 11 69,796,700 (GRCm39) missense probably benign 0.00
R7871:Neurl4 UTSW 11 69,794,012 (GRCm39) missense probably benign
R8092:Neurl4 UTSW 11 69,801,891 (GRCm39) missense probably benign
R8121:Neurl4 UTSW 11 69,799,056 (GRCm39) splice site probably null
R8131:Neurl4 UTSW 11 69,800,067 (GRCm39) missense probably benign 0.12
R8289:Neurl4 UTSW 11 69,800,206 (GRCm39) critical splice donor site probably null
R8354:Neurl4 UTSW 11 69,800,062 (GRCm39) missense probably damaging 0.97
R8494:Neurl4 UTSW 11 69,801,871 (GRCm39) missense probably benign 0.02
R8529:Neurl4 UTSW 11 69,799,613 (GRCm39) missense probably damaging 1.00
R8850:Neurl4 UTSW 11 69,794,788 (GRCm39) unclassified probably benign
R8992:Neurl4 UTSW 11 69,798,958 (GRCm39) missense possibly damaging 0.69
R9334:Neurl4 UTSW 11 69,796,792 (GRCm39) missense probably damaging 1.00
R9509:Neurl4 UTSW 11 69,792,971 (GRCm39) nonsense probably null
R9705:Neurl4 UTSW 11 69,799,679 (GRCm39) missense probably damaging 0.97
R9707:Neurl4 UTSW 11 69,799,679 (GRCm39) missense probably damaging 0.97
X0025:Neurl4 UTSW 11 69,797,627 (GRCm39) missense probably damaging 1.00
Z1177:Neurl4 UTSW 11 69,794,916 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCAGAAGATGGTAGATCGTTGGTC -3'
(R):5'- GAGGCCCAGTTCTGTCTTTG -3'

Sequencing Primer
(F):5'- AGATCGTTGGTCAGGCTCCATC -3'
(R):5'- TTGTCCCTAGAATTCCCACAGAG -3'
Posted On 2022-11-14